Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17930

Dio3 deiodinase, iodothyronine type III ( MGI:1306782)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17930 EMAGE:17930 EMAGE:17930 EMAGE:17930 EMAGE:17930
"Pseudo-wholemount" of euxassay_011685. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011685_01 euxassay_011685_02 euxassay_011685_03 euxassay_011685_04
EMAGE:17930 EMAGE:17930 EMAGE:17930 EMAGE:17930 EMAGE:17930
euxassay_011685_05 euxassay_011685_06 euxassay_011685_07 euxassay_011685_08 euxassay_011685_09
EMAGE:17930 EMAGE:17930 EMAGE:17930 EMAGE:17930 EMAGE:17930
euxassay_011685_10 euxassay_011685_11 euxassay_011685_12 euxassay_011685_13 euxassay_011685_14
EMAGE:17930 EMAGE:17930 EMAGE:17930 EMAGE:17930 EMAGE:17930
euxassay_011685_15 euxassay_011685_16 euxassay_011685_17 euxassay_011685_18 euxassay_011685_19
EMAGE:17930 EMAGE:17930 EMAGE:17930 EMAGE:17930 EMAGE:17930
euxassay_011685_20 euxassay_011685_21 euxassay_011685_22 euxassay_011685_23 euxassay_011685_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17930Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17930_wholemount_strong.wlz
17930_wholemount_moderate.wlz
17930_wholemount_weak.wlz
17930_wholemount_possible.wlz
17930_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17930_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 08 15 16 17 moderate expression: see section 09 11
telencephalon mantle layer
strong strong
single cellstrong expression: see section 08 13 14 19 20 moderate expression: see section 11 12 15
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 03 04 moderate expression: see section 05 weak expression: see section 06 20 21 22 23
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 12 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37675
Entity Detected:Dio3, deiodinase, iodothyronine type III ( MGI:1306782)
Sequence:sense strand is shown

>T37675
GCGACGTTGACTTCCTTATCATCTACATCGAGGAAGCCCACCCATCCGACGGCTGGGTCACCACAGATTC
ACCCTATGTCATCCCCCAGCACCGCAGCCTGGAGGACCGTGTCAGCGCAGCGAGAGTACTACAACAAGGT
GCACCTGGCTGTGCTCTGGTCCTGGACACTATGGCCAACTCTAGCAGTTCCGCATATGGTGCCTATTTTG
AGCGCCTCTACGTCATCCAGAGTGGCACCATCATGTACCAGGGAGGCCGTGGCCCCGACGGTTACCAGGT
GTCTGAGTTGCGCACTTGGTTGGAGCGCTATGATGAACAGTTGCATGGTACTAGGCCACATCGATTCTAA
ATAACCAAGGGACAAGTGACTGAATTGGTGGGCCGGGTCTCCTGGGCCTTCGAAGCCCACGTGCAAATGC
TCCAAAGAAAGTCAAAGGTTGTGGGGGATCCCCATGACACAGATGAGCACAGCCACAGAACTCAGGCTGA
GTCTGGCTAACTTGAGACTCTGCTATAGTGACTCCCTTTTGTACGTTTTTGGCTTGCTCTCAGGAGCATT
GCTGTGGCTCGAACTGACAGCTTTGTCCCTGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 67022. Forward Primer - name:067022_F_cDNA_Dio3, sequence:GCGACGTTGACTTCCTTATCAT; Reverse Primer - name:067022_N_SP6_cDNA_Dio3, sequence:AGCAGGGACAAAGCTGTCAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17929 same embryo
 EMAGE:17931 same embryo
 EurExpress:euxassay_011685 same experiment
 MGI:4824309 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS