Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17931

Stk32b serine/threonine kinase 32B ( MGI:1927552)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17931 EMAGE:17931 EMAGE:17931 EMAGE:17931 EMAGE:17931
"Pseudo-wholemount" of euxassay_011693. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011693_01 euxassay_011693_02 euxassay_011693_03 euxassay_011693_04
EMAGE:17931 EMAGE:17931 EMAGE:17931 EMAGE:17931 EMAGE:17931
euxassay_011693_05 euxassay_011693_06 euxassay_011693_07 euxassay_011693_08 euxassay_011693_09
EMAGE:17931 EMAGE:17931 EMAGE:17931 EMAGE:17931 EMAGE:17931
euxassay_011693_10 euxassay_011693_11 euxassay_011693_12 euxassay_011693_13 euxassay_011693_14
EMAGE:17931 EMAGE:17931 EMAGE:17931 EMAGE:17931 EMAGE:17931
euxassay_011693_15 euxassay_011693_16 euxassay_011693_17 euxassay_011693_18 euxassay_011693_19
EMAGE:17931 EMAGE:17931 EMAGE:17931 EMAGE:17931 EMAGE:17931
euxassay_011693_20 euxassay_011693_21 euxassay_011693_22 euxassay_011693_23 euxassay_011693_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17931Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17931_wholemount_strong.wlz
17931_wholemount_moderate.wlz
17931_wholemount_weak.wlz
17931_wholemount_possible.wlz
17931_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17931_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 15 16 17 18 19
foot
weak weak
regionalweak expression: see section 04 06 20 21
hip
weak weak
regionalweak expression: see section 15
fibula
weak weak
regionalweak expression: see section 03 23
tibia
weak weak
regionalweak expression: see section 03 23
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 19 20 21 22 23 24 weak expression: see section 02 09 10 11 12 16 17 18
olfactory cortex marginal layer
weak weak
regionalweak expression: see section 11 12 16 17 18
ventral grey horn
weak weak
regionalweak expression: see section 07 08 09 10 11 12
otic capsule
weak weak
regionalweak expression: see section 07 08 09 17 18 19
nasal septum
weak weak
regionalweak expression: see section 12 13 16 17
thyroid cartilage
weak weak
regionalweak expression: see section 10 11 12
trachea
weak weak
regionalweak expression: see section 11 12
exoccipital bone
weak weak
regionalweak expression: see section 01 02 03 04 19 20 22 23 24
temporal bone petrous part
weak weak
regionalweak expression: see section 01 02 03 04 19 20 21 22 23 24
vault of skull
weak weak
regionalweak expression: see section 01 02
orbito-sphenoid
weak weak
regionalweak expression: see section 02 24
viscerocranium
weak weak
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37089
Entity Detected:Stk32b, serine/threonine kinase 32B ( MGI:1927552)
Sequence:sense strand is shown

>T37089
GCAGATATGTAAACTCCTGGGCATTGATCAAGTGTTTATACATGTAAATTATCTCAATATCTAAAGTGTC
CTCCCTAGCCCCCACACAATTTTAACCATGAGAACTTTGCAATTTGGCCCATCCTAGTTTGCTTGATGGA
ACTTTCAACAACATAAATAGCTGATATGTTTGTCCCTCTTATGGGACTTCCAGGTTCCAAAGCAACCAGG
AAGAGTCACACACAGACTTCCTGGCCTTCTGGAATGGTGCAGCATAAAGACCAAGCCCAGGAGTTTCTGC
TGCAAACAGGTTTTTCCCTGACTCGTGGAAGGCTGCCCCCACATTTGGATTCCAGCAATCACCAGCTATC
ACCATATCCCCACATCCCCGTGTTAGATGGCACTGTGTCTCTGGCCACTCCTCCCCACCACAGAGTGTCC
TGGGATCCCAGAGGAGACTCATCCTGCAGCGTGACCTCAGTCCCCACCAGGAAGAATATAAGAGTCCAGT
CAGCCTGTCATGCAAAGGCTCCCTGGCTGGGTAGTCAGAGCTTCCTGTTGATACCTTAGGAAGCCTCGGT
GCTTAGAGTCTTCTGTAGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91036. Forward Primer - name:091036_F_cDNA_Stk32b, sequence:GCAGATATGTAAACTCCTGGGC; Reverse Primer - name:091036_N_SP6_cDNA_Stk32b, sequence:TCTACAGAAGACTCTAAGCACCG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17930 same embryo
 EMAGE:17929 same embryo
 EurExpress:euxassay_011693 same experiment
 MGI:4828501 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS