Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17937

E030010N08Rik RIKEN cDNA E030010N08 gene ( MGI:3045962)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17937 EMAGE:17937 EMAGE:17937 EMAGE:17937 EMAGE:17937
"Pseudo-wholemount" of euxassay_011697. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011697_01 euxassay_011697_02 euxassay_011697_03 euxassay_011697_04
EMAGE:17937 EMAGE:17937 EMAGE:17937 EMAGE:17937 EMAGE:17937
euxassay_011697_05 euxassay_011697_06 euxassay_011697_07 euxassay_011697_08 euxassay_011697_09
EMAGE:17937 EMAGE:17937 EMAGE:17937 EMAGE:17937 EMAGE:17937
euxassay_011697_10 euxassay_011697_11 euxassay_011697_12 euxassay_011697_13 euxassay_011697_14
EMAGE:17937 EMAGE:17937 EMAGE:17937 EMAGE:17937 EMAGE:17937
euxassay_011697_15 euxassay_011697_16 euxassay_011697_17 euxassay_011697_18 euxassay_011697_19
EMAGE:17937 EMAGE:17937 EMAGE:17937 EMAGE:17937 EMAGE:17937
euxassay_011697_20 euxassay_011697_21 euxassay_011697_22 euxassay_011697_23 euxassay_011697_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17937Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17937_wholemount_strong.wlz
17937_wholemount_moderate.wlz
17937_wholemount_weak.wlz
17937_wholemount_possible.wlz
17937_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17937_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 23 24 weak expression: see section 20 21 22
diencephalon
moderate moderate
spottedmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
pituitary gland
moderate moderate
spottedmoderate expression: see section 11 12 13 14 15
telencephalon
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hindbrain
moderate moderate
spottedmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain
moderate moderate
spottedmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 weak expression: see section 19 20
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 weak expression: see section 07 08 09 17 18 19 20 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 08 16
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 17
spinal cord
moderate moderate
spottedmoderate expression: see section 07 08 09 10 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 13 14 15 weak expression: see section 16
lung
strong strong
spottedstrong expression: see section 02 03 05 06 07 09 14 15 16 17 18 19 21 moderate expression: see section 04 08 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37685
Entity Detected:E030010N08Rik, RIKEN cDNA E030010N08 gene ( MGI:3045962)
Sequence:sense strand is shown

>T37685
GCTGTTCCAGAATCTCCCATACTACACACCCCCCCCCCCAAAAAAATGCTAGAAAATGCCAGTGGGTAAT
CCTGCTCTTGTTGCTATGGAGACCAAGGCCATCATCTTACCAGACCCGTTCCTGCCTCACCTCTTGGCAT
CTATGTGCCTTCCTCTTATTTAGCGCTGGTCAGACTGACCTGTCTTCCCTTCCAACAAGTCTCTTTGGCC
TTGTAAACGGCACTTTCTAGTACCCCTAGACTACTGGGCAACCTGGTAAATTCTTGCTTGCACCACAGGG
TGCAGGTCATCCCATGGCTTGTGTTTCTGCCAGGACCTCCTGAAGCCTCTTCAAGGACTCTGGCATGGGG
CAGGAAAGGCAGAAAACTCCTGGAATCCATCCAATCACAGGCATGTAGCTAAGGCCAAGATATGTGACAG
CCTGTCAGTTTACTTCAAGATCACCAGGGACTTAAAATCAGCCATCCTGTCAGACCTCTGGTTGAACTTA
ATCCGCAATTGAGGTGGACAGACAGGCTTTATTGCCGATGACAGTGTGAAGAAGGGTCCTGAAGCCCAGG
CTCTGAAAGGAAGAACACAGAGACCAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 75832. Forward Primer - name:075832_F_cDNA_E030010N08Rik, sequence:GCTGTTCCAGAATCTCCCATAC; Reverse Primer - name:075832_N_SP6_cDNA_E030010N08Rik, sequence:ATGGTCTCTGTGTTCTTCCTTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17938 same embryo
 EurExpress:euxassay_011697 same experiment
 MGI:4824442 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS