Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17942

Tgfa transforming growth factor alpha ( MGI:98724)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17942 EMAGE:17942 EMAGE:17942 EMAGE:17942 EMAGE:17942
"Pseudo-wholemount" of euxassay_011705. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011705_01 euxassay_011705_02 euxassay_011705_03 euxassay_011705_04
EMAGE:17942 EMAGE:17942 EMAGE:17942 EMAGE:17942 EMAGE:17942
euxassay_011705_05 euxassay_011705_06 euxassay_011705_07 euxassay_011705_08 euxassay_011705_09
EMAGE:17942 EMAGE:17942 EMAGE:17942 EMAGE:17942 EMAGE:17942
euxassay_011705_10 euxassay_011705_11 euxassay_011705_12 euxassay_011705_13 euxassay_011705_14
EMAGE:17942 EMAGE:17942 EMAGE:17942 EMAGE:17942 EMAGE:17942
euxassay_011705_15 euxassay_011705_16 euxassay_011705_17 euxassay_011705_18 euxassay_011705_19
EMAGE:17942 EMAGE:17942 EMAGE:17942 EMAGE:17942 EMAGE:17942
euxassay_011705_20 euxassay_011705_21 euxassay_011705_22 euxassay_011705_23 euxassay_011705_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17942Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17942_wholemount_strong.wlz
17942_wholemount_moderate.wlz
17942_wholemount_weak.wlz
17942_wholemount_possible.wlz
17942_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17942_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 06 21 22 23 24 weak expression: see section 05
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 02 11 12 13 14 16 17 18
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08
pons mantle layer
weak weak
regionalweak expression: see section 08 09 18
saccule mesenchyme
moderate moderate
regionalmoderate expression: see section 16 17
utricle mesenchyme
moderate moderate
regionalmoderate expression: see section 18 19 20
naris
moderate moderate
regionalmoderate expression: see section 12 14 15 16
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 15 16 17 18 19 20
nasal septum
moderate moderate
regionalmoderate expression: see section 14
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
vomeronasal organ
strong strong
regionalstrong expression: see section 12 13 15 16
thyroid cartilage
weak weak
regionalweak expression: see section 10 11 14
trachea cartilaginous ring
weak weak
regionalweak expression: see section 12
basioccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 18 19 20 21 22 23 24
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 18 19 20 21 22 23 24
orbital fissure
moderate moderate
regionalmoderate expression: see section 05
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 06 07 08 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37129
Entity Detected:Tgfa, transforming growth factor alpha ( MGI:98724)
Sequence:sense strand is shown

>T37129
TGAAACTGTTCAGTGCTGTCCTCTAACTGCTTAGCTGACACAGCTCCAGGCAGAAGTTGTCATTCTTGCT
ATTATTTTGGTTTGATGCTTTATCTTGTTTTGTGAGACAAGGTCTTGCTGTGTAGCCCAGGTTGACCTTT
AAGTTAAGATCCTCCTGCTTCAGCAACCTGGAAGCTGGGCTTACAGATGTGCACCACCACGCCCAGCACT
TTTTGATTACTAGAGAAAATAGGTTAAGTTTGCTTTCCTTGGGTCATACAAGTGGGTCAAGGCCAAGTGT
CACCTGCTGCTCAGACACCAATCAACCTCACTGGACTTCAGCCCTCTATTGGCCCCCAGTGCTCTCAGTA
GACCCCGCCTGAAGTACTGGCTCACTGGAGGGCAGGGAGCAACACAAATGGAGGAGATGTGGGGCTTGTT
TTAGTTTAGTTCACACTGTTAGCTTCTGATGACAGGTCTTTTCTGGTCTGCTGGAGGCTCCTGGGTGTCT
GACTTCTTTTAAAGAGTTTGAACTGATATCAAAATATCATTGGGAACTTCCTCACTTAATATCCCATCCT
GAAGATGTTGTCATCCAAGACTAAGCAGAGGTGGTAAACGCTTAGCACGAGCACTCGATGGTGAAGGCAG
AGGATCTCGGGAGGACCTCAGCTTTAGTGTCCGAACGGTCCTGTTCTCAGGTCCAGCCAGTCGCAGCAGC
CAGTACCATCCCAGTGCCTGTACACAGATGCAGCTGGCTCAAACACCTCCCAGAAGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90446. Forward Primer - name:090446_F_cDNA_Tgfa, sequence:TGAAACTGTTCAGTGCTGTCCT; Reverse Primer - name:090446_N_SP6_cDNA_Tgfa, sequence:CACTTCTGGGAGGTGTTTGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17944 same embryo
 EMAGE:17943 same embryo
 EMAGE:17945 same embryo
 EMAGE:17947 same embryo
 EMAGE:17946 same embryo
 EurExpress:euxassay_011705 same experiment
 MGI:4828677 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS