Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17953

Tjp1 tight junction protein 1 ( MGI:98759)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17953 EMAGE:17953 EMAGE:17953 EMAGE:17953 EMAGE:17953
"Pseudo-wholemount" of euxassay_011726. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011726_01 euxassay_011726_02 euxassay_011726_03 euxassay_011726_04
EMAGE:17953 EMAGE:17953 EMAGE:17953 EMAGE:17953 EMAGE:17953
euxassay_011726_05 euxassay_011726_06 euxassay_011726_07 euxassay_011726_08 euxassay_011726_09
EMAGE:17953 EMAGE:17953 EMAGE:17953 EMAGE:17953 EMAGE:17953
euxassay_011726_10 euxassay_011726_11 euxassay_011726_12 euxassay_011726_13 euxassay_011726_14
EMAGE:17953 EMAGE:17953 EMAGE:17953 EMAGE:17953 EMAGE:17953
euxassay_011726_15 euxassay_011726_16 euxassay_011726_17 euxassay_011726_18 euxassay_011726_19
EMAGE:17953 EMAGE:17953 EMAGE:17953 EMAGE:17953 EMAGE:17953
euxassay_011726_20 euxassay_011726_21 euxassay_011726_22 euxassay_011726_23 euxassay_011726_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17953Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17953_wholemount_strong.wlz
17953_wholemount_moderate.wlz
17953_wholemount_weak.wlz
17953_wholemount_possible.wlz
17953_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17953_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 09 10
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 11
midbrain meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
spinal cord
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 11 12
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12
metanephros
moderate moderate
regionalmoderate expression: see section 03 04 weak expression: see section 12 13 14 15
left lung
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08
right lung
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37138
Entity Detected:Tjp1, tight junction protein 1 ( MGI:98759)
Sequence:sense strand is shown

>T37138
TGTGTTTCTGTCCTGATTGACCACTTTTAATTCTTAGTGTATAGGAACTGGACTAAGCAATGTGAACGTG
GATTGAACTTACTAAATCTAAATGGAACCACTCTAATGAGTATTATATTTTCTTAGAATTTATACTGCAA
TTGGTAGTATTAAGCATTTGTTGGAACTGATGAAGGTTAGCGAGCATGCCCCTGAGCCACGGTCAGAAAG
CATGCTACAAGCTATGTGTTATTGAGTGAAGAACTGTCAGGCATTGGCTAGAGGTTCAAAGATATTTTTG
CTTTGTAATGATTTTTGTACTTTTTTATGGTCACTGCTTAACTTCACATACTGATTTCCGTTAAAAATAC
CAGCCAGTAAATGGGGGTGCATTTGAGTTCTGTTCTTTCCAAAGTACACTCAAAGTTTATTATGGCCTTG
GCCTAGCATACACATTTTATTTTATTATACATGAGGTAATGTGCACACATTTTTTACAAATGCACCTGGA
ATATATAACCAGTATAGTGGATTTAACAGAAATGTACAGCAGGGGGATTTATAACTTGGGGAGGGAGGGT
CAAATGAAGACAATTACTTATTGTATATGAAAACACATTTCTTTTAGGGAAGGACACCAAAGCATGTGAG
C
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74182. Forward Primer - name:074182_F_cDNA_Tjp1, sequence:TGTGTTTCTGTCCTGATTGACC; Reverse Primer - name:074182_N_SP6_cDNA_Tjp1, sequence:GCTCACATGCTTTGGTGTCCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17956 same embryo
 EMAGE:17954 same embryo
 EMAGE:17955 same embryo
 EurExpress:euxassay_011726 same experiment
 MGI:4828731 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS