Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17970

Gpc5 glypican 5 ( MGI:1194894)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17970 EMAGE:17970 EMAGE:17970 EMAGE:17970 EMAGE:17970
"Pseudo-wholemount" of euxassay_011731. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011731_01 euxassay_011731_02 euxassay_011731_03 euxassay_011731_04
EMAGE:17970 EMAGE:17970 EMAGE:17970 EMAGE:17970 EMAGE:17970
euxassay_011731_05 euxassay_011731_06 euxassay_011731_07 euxassay_011731_08 euxassay_011731_09
EMAGE:17970 EMAGE:17970 EMAGE:17970 EMAGE:17970 EMAGE:17970
euxassay_011731_10 euxassay_011731_11 euxassay_011731_12 euxassay_011731_13 euxassay_011731_14
EMAGE:17970 EMAGE:17970 EMAGE:17970 EMAGE:17970 EMAGE:17970
euxassay_011731_15 euxassay_011731_16 euxassay_011731_17 euxassay_011731_18 euxassay_011731_19
EMAGE:17970 EMAGE:17970 EMAGE:17970
euxassay_011731_20 euxassay_011731_21 euxassay_011731_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17970Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17970_wholemount_strong.wlz
17970_wholemount_moderate.wlz
17970_wholemount_weak.wlz
17970_wholemount_possible.wlz
17970_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17970_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
foot
strong strong
regionalstrong expression: see section 20 moderate expression: see section 03 04 05 19 21
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
strong strong
single cellstrong expression: see section 03 04 05 06 07 08 09 19 20 21 22
olfactory cortex marginal layer
strong strong
single cellstrong expression: see section 10 11 12 13 15 16 17 18
medulla oblongata alar plate mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 10 11 12 14 15 16
rest of cerebellum mantle layer
strong strong
single cellstrong expression: see section 10 11 12 14 15 16
pons mantle layer
strong strong
single cellstrong expression: see section 10 11 12 14 15 16
midbrain mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
spinal cord mantle layer
strong strong
single cellstrong expression: see section 10 11 12 13 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37728
Entity Detected:Gpc5, glypican 5 ( MGI:1194894)
Sequence:sense strand is shown

>T37728
TCCACACTGGCATGCTTATATCCGGTCTTTGGAAGAGTTGTCAGATGCGATGCACGGAACCTACGACGTT
GAACACGTGCTCCTGAACTTCCACTTGCTTGTTAATGATGCCGTGTTGCAGGCTCACCTCAATGGGCAGA
AATTATTGGATCAGGTGAATACGATTTGTGGCCATCCAGTGAGAACACCAACACAGAGCCCCCGCTGTAC
TTTTGACCCAAGCAAAGAGAAACATGGAATGAAGATCTCTGCAAGGAATGGTGAAGAGACACTTGCCAAC
AGAAGAAAAGAATTCATCAATAGCCTTAGGCTGCATGGGTCCTTCTATGGTGGCCTGGCTGACCAGCTTT
GTGTTAATGAATTGGCTGCCCCTGAAGGAAGGCCCTGCTGGAATGGGGAGGAAATAGTCAAAAGCTATGC
TCAGCGTGTGGTTGGGAATGGAATCAAAGCCCAGTCTGCAAATCCTGAAGTCAGAGTCAGAGGAACCGAT
CCTGTGGTAAATCAGATCATTGATAAACTGAAGCATGTCATCCAGTTGTTACGGGGGAGATCACCCAAGC
CCAACAAGTGGGAGCTCCTTCAGCCAGGCAGTGGAGGCGGCATGCTTGAGAACTCTAGTGGAGACTGTGA
TGACGAAGATGGCTGTGGAGGATCAGGAAGCGGAGAAGTAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 68777. Forward Primer - name:068777_F_cDNA_Gpc5, sequence:TCCACACTGGCATGCTTATATC; Reverse Primer - name:068777_N_SP6_cDNA_Gpc5, sequence:TTACTTCTCCGCTTCCTGATCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17971 same embryo
 EMAGE:17972 same embryo
 EMAGE:17969 same embryo
 EurExpress:euxassay_011731 same experiment
 MGI:4825158 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS