Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17989

Tcerg1l transcription elongation regulator 1-like ( MGI:1917821)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17989 EMAGE:17989 EMAGE:17989 EMAGE:17989 EMAGE:17989
"Pseudo-wholemount" of euxassay_011754. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011754_01 euxassay_011754_02 euxassay_011754_03 euxassay_011754_04
EMAGE:17989 EMAGE:17989 EMAGE:17989 EMAGE:17989 EMAGE:17989
euxassay_011754_05 euxassay_011754_06 euxassay_011754_07 euxassay_011754_08 euxassay_011754_09
EMAGE:17989 EMAGE:17989 EMAGE:17989 EMAGE:17989 EMAGE:17989
euxassay_011754_10 euxassay_011754_11 euxassay_011754_12 euxassay_011754_13 euxassay_011754_14
EMAGE:17989 EMAGE:17989 EMAGE:17989 EMAGE:17989 EMAGE:17989
euxassay_011754_15 euxassay_011754_16 euxassay_011754_17 euxassay_011754_18 euxassay_011754_19
EMAGE:17989 EMAGE:17989 EMAGE:17989 EMAGE:17989 EMAGE:17989
euxassay_011754_20 euxassay_011754_21 euxassay_011754_22 euxassay_011754_23 euxassay_011754_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17989Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17989_wholemount_strong.wlz
17989_wholemount_moderate.wlz
17989_wholemount_weak.wlz
17989_wholemount_possible.wlz
17989_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17989_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
moderate moderate
spottedmoderate expression: see section 05 06 07 08 12 13 16 17 18 19 20 21 22 23
medulla oblongata alar plate mantle layer
moderate moderate
spottedmoderate expression: see section 05 06 07 08 10 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
spottedmoderate expression: see section 05 07 08 10 11 12 13 14 15 16
medulla oblongata basal plate marginal layer
moderate moderate
spottedmoderate expression: see section 06
rest of cerebellum mantle layer
moderate moderate
spottedmoderate expression: see section 05 06 07 11 12 13 15 16
pons mantle layer
moderate moderate
spottedmoderate expression: see section 04 05 06 07 08 10 11 12 14 15 16 17 18
pons marginal layer
moderate moderate
spottedmoderate expression: see section 13
midbrain mantle layer
moderate moderate
spottedmoderate expression: see section 06 07 11 12 13 14 15 16
tegmentum
moderate moderate
spottedmoderate expression: see section 11 12 13 14
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 20 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
spinal cord mantle layer
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37116
Entity Detected:Tcerg1l, transcription elongation regulator 1-like ( MGI:1917821)
Sequence:sense strand is shown

>T37116
CTCTCCCCACTGTGGTATTAGCAGCTCAACCCATACCAGGTGGTTGTCATGACAGTCTTAAGCCAATCAG
CAGGGGTCCCACCATCACCATCACTGCTGCCACAGCTGCTGCTGCAGCTACTGCCATGGTCTCTGTAGAC
CCCGAGGAACTCCGGGGCCTGAGCCCCTCCATCATGCAGCCGTGCCACTTCCTGACATTGACCCCCATCA
GAATCCCCTTCCGGACTGCCCCATTCTCAGATAAAGGCAAAGAGCACAGGCGTGCACCCCGTTCCCCTGC
CCTGATGCTACGTGCCCCAGAGAGGAAAAGCTTGGTGGGAGACAAGGAGGATAAGGAGCCTTCACCCATA
TTGGTAAGAGGGGAGGAAACTGCAGCGAAAGGCAATAACCCAGTGGCCTCCACGCCTGTGCCTGGATCCC
CTTGGTGTGTGGTCTGGACGGGTGATGACCGGGTTTTCTTCTTCAACCCGACCATGCAGCTGTCAGTCTG
GGAGAAGCCAGTGGACCTACAGAACCGTGGGGACCTCAAGAGAATCATCGAGGACCCACCCCACAAACGC
AAGCTGGAGGCCTCAGCAAGTAATTAGGAGGGAATGCGGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 75082. Forward Primer - name:075082_F_cDNA_Tcerg1l, sequence:CTCTCCCCACTGTGGTATTAGC; Reverse Primer - name:075082_N_SP6_cDNA_Tcerg1l, sequence:CACCGCATTCCCTCCTAATTACT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4828634 same experiment
 EurExpress:euxassay_011754 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS