Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18000

Gda guanine deaminase ( MGI:95678)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18000 EMAGE:18000 EMAGE:18000 EMAGE:18000 EMAGE:18000
"Pseudo-wholemount" of euxassay_011767. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011767_01 euxassay_011767_02 euxassay_011767_03 euxassay_011767_04
EMAGE:18000 EMAGE:18000 EMAGE:18000 EMAGE:18000 EMAGE:18000
euxassay_011767_05 euxassay_011767_06 euxassay_011767_07 euxassay_011767_08 euxassay_011767_09
EMAGE:18000 EMAGE:18000 EMAGE:18000 EMAGE:18000 EMAGE:18000
euxassay_011767_10 euxassay_011767_11 euxassay_011767_12 euxassay_011767_13 euxassay_011767_14
EMAGE:18000 EMAGE:18000 EMAGE:18000 EMAGE:18000 EMAGE:18000
euxassay_011767_15 euxassay_011767_16 euxassay_011767_17 euxassay_011767_18 euxassay_011767_19
EMAGE:18000 EMAGE:18000 EMAGE:18000 EMAGE:18000
euxassay_011767_20 euxassay_011767_21 euxassay_011767_22 euxassay_011767_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18000Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18000_wholemount_strong.wlz
18000_wholemount_moderate.wlz
18000_wholemount_weak.wlz
18000_wholemount_possible.wlz
18000_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18000_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal medulla
weak weak
homogeneousweak expression: see section 04 05 06 07 12 13
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 05 06 07 14
cervical ganglion
weak weak
regionalweak expression: see section 06 07 15
thoracic ganglion
weak weak
regionalweak expression: see section 09 10 11
dorsal root ganglion
weak weak
regionalweak expression: see section 04 05 06 08 11 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37717
Entity Detected:Gda, guanine deaminase ( MGI:95678)
Sequence:sense strand is shown

>T37717
GAGAGGGCACAAGCTAGACATTGAAAAGACATTGGAAAAGTCATTGGTTGTGCTTGGAAATTTAATATAG
AGAACAGTCTCGTAAAAGGAGAACCTACTGGATTTAAAACATGCTTCTAGATCGACATTGTCTATGGACA
TTTGCACTTTGTGAAATTTGCATTTCAGGATGTGTTATTGTTATGCTTTCCCTTCTTGGGATGAATGTCA
GAACCTGAATGCCACACGCTTTTCAAATATAGTTCTATGCTTCAAAGTGTTCGGCAGAAGTTGAGTATTA
AAGATTTAAAGTCTCTTAGGGATAGTATTCACATAGCCGCAAGGCATAAATAGTTGTGTTTTTTTGTGTG
TGTGTGTACTTCAAAGTCATCTTGATTCCTGGCTGTGAGGTGTTCCAGTTGCTTCTGTTTTATTAGATGA
GAAACAAGCCCTGTGTGTTGCTGCTCTGTAGACTGGAGTTTTCATAAATCGGGGAAGTACTATATTCCCC
GGAGTTGGTGACACTGAGGGGACAGGGTTCTTTGCAATGCTGAATCTACCCAACGCATAATCATTGCTGT
ACAGTTCACCCTCCTATCAATGTGCTAGAAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74322. Forward Primer - name:074322_F_cDNA_Gda, sequence:GAGAGGGCACAAGCTAGACATT; Reverse Primer - name:074322_N_SP6_cDNA_Gda, sequence:GTTCTAGCACATTGATAGGAGGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18006 same embryo
 EMAGE:18001 same embryo
 EMAGE:17998 same embryo
 EMAGE:18002 same embryo
 EMAGE:18003 same embryo
 EMAGE:18004 same embryo
 EMAGE:18005 same embryo
 EMAGE:17999 same embryo
 EurExpress:euxassay_011767 same experiment
 MGI:4825028 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS