Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18081

Ccno cyclin O ( MGI:2145534)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18081 EMAGE:18081 EMAGE:18081 EMAGE:18081 EMAGE:18081
"Pseudo-wholemount" of euxassay_011932. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011932_01 euxassay_011932_02 euxassay_011932_03 euxassay_011932_04
EMAGE:18081 EMAGE:18081 EMAGE:18081 EMAGE:18081 EMAGE:18081
euxassay_011932_05 euxassay_011932_06 euxassay_011932_07 euxassay_011932_08 euxassay_011932_09
EMAGE:18081 EMAGE:18081 EMAGE:18081 EMAGE:18081 EMAGE:18081
euxassay_011932_10 euxassay_011932_11 euxassay_011932_12 euxassay_011932_13 euxassay_011932_14
EMAGE:18081 EMAGE:18081 EMAGE:18081 EMAGE:18081 EMAGE:18081
euxassay_011932_15 euxassay_011932_16 euxassay_011932_17 euxassay_011932_18 euxassay_011932_19
EMAGE:18081 EMAGE:18081 EMAGE:18081
euxassay_011932_20 euxassay_011932_21 euxassay_011932_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18081Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18081_wholemount_strong.wlz
18081_wholemount_moderate.wlz
18081_wholemount_weak.wlz
18081_wholemount_possible.wlz
18081_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18081_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 02 03 04 06 07 08 12 13 14 15 16 17 19 20 moderate expression: see section 01 weak expression: see section 05
diencephalon roof plate
strong strong
regionalstrong expression: see section 11 12 13
choroid invagination
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 14 15 16 17
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 02 03 04 06 07 08 12 13 14 15 16 17 19 20 moderate expression: see section 01 weak expression: see section 05
anterior naris epithelium
strong strong
regionalstrong expression: see section 15
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36101
Entity Detected:Ccno, cyclin O ( MGI:2145534)
Sequence:sense strand is shown

>T36101
TGTCTGACCGTGAATACTCTGGACCGTTTTCTCCTCACGACCCCTGTTGCTGCAGACTGCTTCCAGCTGC
TCGGGGTCACCTGTCTGCTCATCGCTTGCAAGCAGGTAGAGGTGCACCCACCTCGCTTGAAACAGCTCCT
GGCCCTGTGCGGCGGTGCGTTCTCCCGGCAGCAGCTGTGCAACCTGGAGTGCATCGTGCTGCATAAGCTC
CACTTCAGCCTGGGCGCGCCCACCATCAACTTCTTCCTGGAGCACTTCACTCAGTGGCGCATGGAAGCCG
GCCAGGCTGAGGTCACCGAAGCTCTAGAGGCTCAAACCCTGGCCCGGGGAGTGGCGGAGCTGAGCCTAAC
GGATTACGCGTTCACTACCTACACGCCGTCCCTGATGGCTATCTGCTGCCTGGCGCTGGCTGACGGATTG
CTGCAGCACCAGCACGAGATGGACCTGCGCCTGGGAGAGCACCCAGAGGCCACACTGCAAGACTGTCTGG
GCAAGCTGCAGACGCTAGTGTCCATCAATAGCAGCTCCCTGCCTCGCATTCTGCCTCCCCAGATCTGGGA
GAGGTGCAGCCTGCCCCAGAGTTGGCAATAAAAAGCACCCCCTTGAGCTCCTTTTTAAAATTCCCTGGTC
CCTGCTCCGTGCCTTAAGGAGAATATGCAGTACAGATCCAAAGAGAAGTTGAGGTCTCCTACCTGTAAAT
ACTGTACAATAACGGATTCTTTATTTATTTTGTAGTACACAAGGGCAGGGGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 84376. Forward Primer - name:084376_F_cDNA_C86987, sequence:TGTCTGACCGTGAATACTCTGG; Reverse Primer - name:084376_N_SP6_cDNA_C86987, sequence:CACCCCTGCCCTTGTGTACTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18080 same embryo
 EMAGE:18079 same embryo
 EMAGE:18083 same embryo
 EMAGE:18078 same embryo
 EMAGE:18082 same embryo
 EurExpress:euxassay_011932 same experiment
 MGI:4823712 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS