Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18117

Gm10232 predicted pseudogene 10232 ( MGI:3641637)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18117 EMAGE:18117 EMAGE:18117 EMAGE:18117 EMAGE:18117
"Pseudo-wholemount" of euxassay_011936. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011936_01 euxassay_011936_02 euxassay_011936_03 euxassay_011936_04
EMAGE:18117 EMAGE:18117 EMAGE:18117 EMAGE:18117 EMAGE:18117
euxassay_011936_05 euxassay_011936_06 euxassay_011936_07 euxassay_011936_08 euxassay_011936_09
EMAGE:18117 EMAGE:18117 EMAGE:18117 EMAGE:18117 EMAGE:18117
euxassay_011936_10 euxassay_011936_11 euxassay_011936_12 euxassay_011936_13 euxassay_011936_14
EMAGE:18117 EMAGE:18117 EMAGE:18117 EMAGE:18117 EMAGE:18117
euxassay_011936_15 euxassay_011936_16 euxassay_011936_17 euxassay_011936_18 euxassay_011936_19
EMAGE:18117 EMAGE:18117 EMAGE:18117 EMAGE:18117
euxassay_011936_20 euxassay_011936_21 euxassay_011936_22 euxassay_011936_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18117Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18117_wholemount_strong.wlz
18117_wholemount_moderate.wlz
18117_wholemount_weak.wlz
18117_wholemount_possible.wlz
18117_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18117_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 13 14 15 16 17 18 19 20 21 22
radius
moderate moderate
homogeneousmoderate expression: see section 01
ulna
moderate moderate
homogeneousmoderate expression: see section 01
humerus
moderate moderate
homogeneousmoderate expression: see section 01 02 03 19 20 21 22 23
fibula
moderate moderate
homogeneousmoderate expression: see section 03
tibia
moderate moderate
homogeneousmoderate expression: see section 02 03 04
femur
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 18 19 20 21 22 23
otic capsule
moderate moderate
homogeneousmoderate expression: see section 05 06 07 14 15
naris
moderate moderate
homogeneousmoderate expression: see section 12 13 15 16 17
nasal septum
moderate moderate
homogeneousmoderate expression: see section 13 14
viscerocranium
moderate moderate
homogeneousExpression in the turbinate bone.
meckel's cartilage
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14
basioccipital bone
moderate moderate
homogeneousmoderate expression: see section 02 03 14 15 16 17 18 19 20 21
basisphenoid bone
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 13 14
temporal bone petrous part
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 17 18 19 20 21 22
vault of skull
moderate moderate
homogeneousmoderate expression: see section 01
orbito-sphenoid
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 18 19 20 23
clavicle
moderate moderate
homogeneousmoderate expression: see section 06 17
scapula
moderate moderate
homogeneousmoderate expression: see section 02 03 18 19
pelvic girdle skeleton
moderate moderate
homogeneousmoderate expression: see section 09 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37185
Entity Detected:Gm10232, predicted pseudogene 10232 ( MGI:3641637)
Sequence:sense strand is shown

>T37185
TAAACCAACCTTTAGCCAGACCATTGCCCTCTTGAACATTTACCGTAACCCTCAAAACTCTTCCCAGTCT
GCTGACGGTTTGCGCTGTGCTGTGAGCGACGTGGAGATGCAGGAGCACTATGATGAGTTCTTTGAGGAAG
TCTTCACTGAGATGGAAGAGAAGTACGGGGAAGTCGAGGAGATGAACGTCTGCGACAACCTAGGGGACCA
CCTGGTGGGGAACGTGTATGTCAAGTTTCGACGTGAGGAGGATGCAGAGAAAGCCGTGATCGACTTGAAT
AACCGTTGGTTTAATGGACAGCCGATCCATGCAGAGCTGTCCCCAGTAACTGACTTCAGGGAAGCCTGCT
GCCGCCAGTATGAAATGGGAGAGTGCACAAGAGGGGGCTTCTGCAACTTCATGCATTTGAAGCCCATCTC
AAGAGAGCTACGACGGGAGCTGTATCGGCGCCGGCGCAAGAAGCATAGATCCAGGTCCCGATCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91171. Forward Primer - name:091171_F_cDNA_U2af1, sequence:TAAACCAACCTTTAGCCAGACC; Reverse Primer - name:091171_N_SP6_cDNA_U2af1, sequence:TGGATCGGGACCTGGATCTAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18118 same assay
 EMAGE:18116 same embryo
 EMAGE:18114 same embryo
 EurExpress:euxassay_011936 same experiment
 MGI:4829043 same experiment
 EMAGE:18115 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS