Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18142

Aldoc aldolase C, fructose-bisphosphate ( MGI:101863)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18142 EMAGE:18142 EMAGE:18142 EMAGE:18142 EMAGE:18142
"Pseudo-wholemount" of euxassay_011944. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011944_01 euxassay_011944_02 euxassay_011944_03 euxassay_011944_04
EMAGE:18142 EMAGE:18142 EMAGE:18142 EMAGE:18142 EMAGE:18142
euxassay_011944_05 euxassay_011944_06 euxassay_011944_07 euxassay_011944_08 euxassay_011944_09
EMAGE:18142 EMAGE:18142 EMAGE:18142 EMAGE:18142 EMAGE:18142
euxassay_011944_10 euxassay_011944_11 euxassay_011944_12 euxassay_011944_13 euxassay_011944_14
EMAGE:18142 EMAGE:18142 EMAGE:18142 EMAGE:18142 EMAGE:18142
euxassay_011944_15 euxassay_011944_16 euxassay_011944_17 euxassay_011944_18 euxassay_011944_19
EMAGE:18142 EMAGE:18142
euxassay_011944_20 euxassay_011944_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18142Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18142_wholemount_strong.wlz
18142_wholemount_moderate.wlz
18142_wholemount_weak.wlz
18142_wholemount_possible.wlz
18142_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18142_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 14
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 moderate expression: see section 05 11 12
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10
pons ventricular layer
strong strong
regionalstrong expression: see section 06 moderate expression: see section 04 05 11 12 13 14
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 10 11 12 13
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 07 08
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30017
Entity Detected:Aldoc, aldolase C, fructose-bisphosphate ( MGI:101863)
Sequence:sense strand is shown

>T30017
ATGCTGGGGCTGCTACTGAGGAGTTTATCAAGCGGGCAGAGATGAACGGGCTTGCAGCCCAGGGCAGATA
TGAAGGCAGTGGAGATGGCGGAGCAGCAGCACAGTCCCTCTACGTCGCCAACCATGCCTACTGAGGCACG
CTGACTCTACCCACAGCCCTTGGCCTAGCAATGCACACCCCATTTTGCCTATAGTCACAGCCAGGGCCAA
ATAGCTATGCAGAACAGAGATATCTTTATCCAGCGCCAAGTCATCTCACATCTCACATGCCTTACATTGC
TGTACCCGAGACCACAGGATGGGAGGGTAGAGATGCCCTCCCATGTTTGAAGATGGGGGGACTTTCTAGA
AGTCAGAACAGAACATGTGGACCTTTTTCCTGTCTCCACCAGCCCTTACAGTTACCCTTGATGGTATAGT
TTGTCCTTGGGCTCTGCTTGCTAATCTTCTCTCTTGGGATCAGGGGGACGTGAACT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3589205), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 12919. Forward Primer - name:012919_F_IRAV12-15_F19_Aldo3, sequence:ATGCTGGGGCTGCTACTG; Reverse Primer - name:012919_R_SP6_IRAV12-15_F19_Aldo3, sequence:GAGTTCACGTCCCCCTGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18144 same embryo
 EMAGE:18143 same embryo
 EMAGE:18141 same embryo
 EMAGE:18145 same embryo
 EurExpress:euxassay_011944 same experiment
 MGI:4823089 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS