Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18147

Fbln2 fibulin 2 ( MGI:95488)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18147 EMAGE:18147 EMAGE:18147 EMAGE:18147 EMAGE:18147
"Pseudo-wholemount" of euxassay_011955. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011955_01 euxassay_011955_02 euxassay_011955_03 euxassay_011955_04
EMAGE:18147 EMAGE:18147 EMAGE:18147 EMAGE:18147 EMAGE:18147
euxassay_011955_05 euxassay_011955_06 euxassay_011955_07 euxassay_011955_08 euxassay_011955_09
EMAGE:18147 EMAGE:18147 EMAGE:18147 EMAGE:18147 EMAGE:18147
euxassay_011955_10 euxassay_011955_11 euxassay_011955_12 euxassay_011955_13 euxassay_011955_14
EMAGE:18147 EMAGE:18147 EMAGE:18147 EMAGE:18147 EMAGE:18147
euxassay_011955_15 euxassay_011955_16 euxassay_011955_17 euxassay_011955_18 euxassay_011955_19
EMAGE:18147 EMAGE:18147
euxassay_011955_20 euxassay_011955_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18147Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18147_wholemount_strong.wlz
18147_wholemount_moderate.wlz
18147_wholemount_weak.wlz
18147_wholemount_possible.wlz
18147_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18147_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 05 06 12 13 14 moderate expression: see section 01 02 03 04 15 16 17 18 19 20
diaphragm
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pericardium
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pleura
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
forearm mesenchyme
moderate moderate
regionalmoderate expression: see section 01
upper arm mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 18 19 20
hand
moderate moderate
regionalmoderate expression: see section 02 03 04 19 20 21
foot
moderate moderate
regionalmoderate expression: see section 20
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 18 19
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 18 19
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 18 19
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 18 19
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 18 19
lower leg mesenchyme
moderate moderate
regionalmoderate expression: see section 17 18 19 20 21
upper leg mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 14 15 16 17 19 20 21
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12
midbrain meninges
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12
otic capsule
strong strong
regionalstrong expression: see section 05 06 07 13 14 15
naris
strong strong
regionalstrong expression: see section 09 10
nasal septum
strong strong
regionalstrong expression: see section 11 12
viscerocranium
strong strong
regionalExpression in the turbinate bone.
heart valve
strong strong
regionalstrong expression: see section 09 10 11 12
stomach mesentery
moderate moderate
regionalmoderate expression: see section 04 05 06 07
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14
urogenital mesentery
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18
axial skeleton
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
basisphenoid bone
strong strong
regionalstrong expression: see section 07 08 09 10 11 12
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 16 17 19 20 21
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 18 20 21
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30019
Entity Detected:Fbln2, fibulin 2 ( MGI:95488)
Sequence:sense strand is shown

>T30019
CCCTCCCCAGAGACACCTGAAGAAATACCCCAGCATCCACAGTTGCTACCTCGATTCCGGGCAGAAGAAG
ACATAGACCCCAACTCAGTACATTCTGTCCCCAGAGGTGATCTTGATGGCTCCACCAAGGACCTAATCGA
GACCTGTTGTGCAGCGGGCCAGCAGTGGGCCATCGACAATGATGAGTGCCAGGAGATCCCCGAGAATGGT
GCCCAGAGTGACATCTGTAGGATAGCCCAGAGGCAATGCTGCATCTCCTACTTGAAAGAGAAGAGCTGTG
TGGCTGGGGTCATGGGAGCCAAGGAGGGTGAGACCTGTGGAGCAGAGGACAATGATACCTGCGGCGTCTC
ACTCTACAAGCAATGCTGTGACTGCTGTGGCCTGGGACTCCGAGTGCGGGCTGAGGGCCAGTCGTGTGAG
TCCAACCCCAACCTTGGCTATCCCTGCAACCATGTCATGCTCTCCTGCTGTGAAGGTGAAGAGCCCCTCA
TAGTGCCTGAGGTCCGCCGGCCACCAGAGCCCGAGGCTGCTCCTCGCAGAGTTTCAGAGACGGAGATGGC
AAGCCGGGAGGCCCTGTCACTGGGCACAGAGGCTGAACTGCCCAATAGCCTGCCGGGAGATGACCAGGAT
GAGTGCCTGATGCTCCCTGGGGAGCTTTGCCAGCATCTTTGCATCAACACCGTCGGCTCCTACCGCTGTG
CCTGCTTCCCTGGATTCGAGCTGCAGGGTGATGGCCGTACCTGCCGCCCAGATAGAGGTGCCCCACAGTT
GGACACTGCACGAGAGTCTGCACCGAGGTCTGAGTCTGCCCAGGTATCTCCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3490759), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 11296. Forward Primer - name:011296_F_IRAV12-15_G07_Fbln2, sequence:CCCTCCCCAGAGACACCT; Reverse Primer - name:011296_R_SP6_IRAV12-15_G07_Fbln2, sequence:TTGGGAGATACCTGGGCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18146 same embryo
 EMAGE:18149 same embryo
 EMAGE:18148 same embryo
 EurExpress:euxassay_011955 same experiment
 MGI:4824789 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS