Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18203

Barx2 BarH-like homeobox 2 ( MGI:109617)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18203 EMAGE:18203 EMAGE:18203 EMAGE:18203 EMAGE:18203
"Pseudo-wholemount" of euxassay_011965. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011965_01 euxassay_011965_02 euxassay_011965_03 euxassay_011965_04
EMAGE:18203 EMAGE:18203 EMAGE:18203 EMAGE:18203 EMAGE:18203
euxassay_011965_05 euxassay_011965_06 euxassay_011965_07 euxassay_011965_08 euxassay_011965_09
EMAGE:18203 EMAGE:18203 EMAGE:18203 EMAGE:18203 EMAGE:18203
euxassay_011965_10 euxassay_011965_11 euxassay_011965_12 euxassay_011965_13 euxassay_011965_14
EMAGE:18203 EMAGE:18203 EMAGE:18203 EMAGE:18203 EMAGE:18203
euxassay_011965_15 euxassay_011965_16 euxassay_011965_17 euxassay_011965_18 euxassay_011965_19
EMAGE:18203 EMAGE:18203 EMAGE:18203 EMAGE:18203
euxassay_011965_20 euxassay_011965_21 euxassay_011965_22 euxassay_011965_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18203Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18203_wholemount_strong.wlz
18203_wholemount_moderate.wlz
18203_wholemount_weak.wlz
18203_wholemount_possible.wlz
18203_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18203_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand
strong strong
regionalstrong expression: see section 03 04
foot
strong strong
regionalstrong expression: see section 10 11 12
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 14 15 18 19 20 21 22 23
sublingual gland primordium
strong strong
homogeneousstrong expression: see section 10 13
submandibular gland primordium
strong strong
homogeneousstrong expression: see section 05 06 07 08 14 15 16 17
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 05 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 15
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 17 18
spinal cord
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 12 13
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 21 22 23
conjunctival sac
strong strong
homogeneousstrong expression: see section 01 02 03 23
cornea
strong strong
homogeneousstrong expression: see section 01 02 03 04 22 23
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 19 20 21 22 23
anterior naris epithelium
moderate moderate
regionalmoderate expression: see section 12 14 15
naso-lacrimal duct
strong strong
regionalstrong expression: see section 05 06 07 10 16 17 18 19 20 21 22 23
tongue muscle
strong strong
regionalstrong expression: see section 11 12 13 14 15 moderate expression: see section 09 10
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30058
Entity Detected:Barx2, BarH-like homeobox 2 ( MGI:109617)
Sequence:sense strand is shown

>T30058
AGACAGAACAGCCCACGCCCAGGCAGAAGAAACCACGCAGAAGTCGCACCATCTTCACCGAGCTGCAGCT
CATGGGCCTAGAGAAGAAATTCCAGAAGCAGAAGTATTTGTCTACCCCAGACAGGTTGGACTTGGCCCAG
TCTCTGGGACTCACTCAGCTGCAAGTGAAGACTTGGTATCAGAATCGCAGGATGAAATGGAAGAAGATGG
TCCTTAAAGGTGGACAGGAAGCACCCACAAAACCTAAGGGGCGCCCTAAGAAGAACTCCATTCCCACATC
AGAGGAGATTGAAGCTGAAGAGAAGATGAACAGCCAGGCTCAGAGCCAGGAGCTGCTGGAATCCTCGGAG
AGACAGGAGGAGCCCTGTGATACCCAGGAGCCCAAAGCGTGCCTTGTCCCCTTGGAGGTGGCAGAACCTA
TTCACCAGCCCCAGGAGTTATCAGAAGCTTCCTCTGAACCCCCACCATTAAGCTAAAATAAAGTTCTTTG
AGGGGAAGGGGGAGCTGGGAAGAAGGGAAGAGAGAGGCAAGGAGAATGAGGGAGAGAAGACCTCTAAAGA
CTAGTAACGTGGGTAGAGGAGCACTTCTGGTCTCCCACATCCCAGCGTCATTTTCATCGGAAGCATTTGA
TGAAGACTCGCTTGTGTGGGACTTAACCTTCTTGCAAGGCTGTGTTAGGCACAGATACCCTTCTGTAAGG
GAGATAGCGCCTTGGATCTGATTGCCCAGGCTTGGGTGATAGCTGCAGGGCTGGCTACAGCAGCTCCGCT
GGCCTGCAGCAAGGGCTGCTCTTCTCCCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3980774), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 17070. Forward Primer - name:017070_F_IRAV20-23_B03_Barx2, sequence:AGACAGAACAGCCCACGC; Reverse Primer - name:017070_R_SP6_IRAV20-23_B03_Barx2, sequence:GGAGGGAGAAGAGCAGCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18201 same embryo
 EMAGE:18200 same embryo
 EMAGE:18205 same embryo
 EMAGE:18204 same embryo
 EMAGE:18202 same embryo
 EurExpress:euxassay_011965 same experiment
 MGI:4823394 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS