Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18231

Stmn3 stathmin-like 3 ( MGI:1277137)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18231 EMAGE:18231 EMAGE:18231 EMAGE:18231 EMAGE:18231
"Pseudo-wholemount" of euxassay_012016. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012016_01 euxassay_012016_02 euxassay_012016_03 euxassay_012016_04
EMAGE:18231 EMAGE:18231 EMAGE:18231 EMAGE:18231 EMAGE:18231
euxassay_012016_05 euxassay_012016_06 euxassay_012016_07 euxassay_012016_08 euxassay_012016_09
EMAGE:18231 EMAGE:18231 EMAGE:18231 EMAGE:18231 EMAGE:18231
euxassay_012016_10 euxassay_012016_11 euxassay_012016_12 euxassay_012016_13 euxassay_012016_14
EMAGE:18231 EMAGE:18231 EMAGE:18231 EMAGE:18231 EMAGE:18231
euxassay_012016_15 euxassay_012016_16 euxassay_012016_17 euxassay_012016_18 euxassay_012016_19
EMAGE:18231
euxassay_012016_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18231Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18231_wholemount_strong.wlz
18231_wholemount_moderate.wlz
18231_wholemount_weak.wlz
18231_wholemount_possible.wlz
18231_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18231_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 01 02 03 04 05 07 13 14
radius
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02
humerus
moderate moderate
regionalmoderate expression: see section 01 02 17 18 19 20
hip
weak weak
regionalweak expression: see section 08 14
fibula
moderate moderate
regionalmoderate expression: see section 01
tibia
moderate moderate
regionalmoderate expression: see section 01
femur
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 17 20 weak expression: see section 16 18 19
diencephalon lateral wall mantle layer
weak weak
homogeneousweak expression: see section 04 05 06 07 08 09 10 11 12 13 14
cerebral cortex marginal layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 10 11 12 14 15 16 17 18 19
telencephalon mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
olfactory cortex marginal layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15
medulla oblongata alar plate mantle layer
weak weak
homogeneousweak expression: see section 06 09 10 11 12
medulla oblongata basal plate mantle layer
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14
rest of cerebellum mantle layer
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
pons mantle layer
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15
midbrain mantle layer
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 01 02 16 17
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 14
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 14 15 16 17 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 07 14
ventral grey horn
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 12 13
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 20
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 01 02 05 17 18 weak expression: see section 03 04 06 07 08 09 10 13 14 15 16
axial skeleton
weak weak
regionalweak expression: see section 05 06 07 08 09
basioccipital bone
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12
basisphenoid bone
weak weak
regionalweak expression: see section 08 09 11 12
exoccipital bone
weak weak
regionalweak expression: see section 01 13 14 15
temporal bone
weak weak
regionalweak expression: see section 18 19 20
orbito-sphenoid
weak weak
regionalweak expression: see section 01 05 06 16 17 18 20
scapula
moderate moderate
regionalmoderate expression: see section 01 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30673
Entity Detected:Stmn3, stathmin-like 3 ( MGI:1277137)
Sequence:sense strand is shown

>T30673
CTGAGCAAGGAGATCCGCGAGGCGCACTTGGCAGCGCTGCGCGAGCGGCTGCGCGAGAAGGAGCTGCACG
CTGCTGAGGTGCGCAGGAACAAGGAGCAGCGGGAGGAAATGTCTGGCTAAGGAGTATTGGACCCAGCGGC
GACAAGAACGTTTTCGGGTTTTGTTTTTGTTTTCAATTCTGTCTAGATGCGAATTTTGTGCCTGCTCCTA
TCTGCTCCCCTGTACCCCTCAGCTTCCTGCTTTTTTCCCACACTCTGAACTGTCCAGTCCTTGTAACGTG
TCTGACCTTGGGCTCTTCCTGAAGGAGCTCCTTAGGCAGGAGATATGGTCCCCTATTCAGACACTAGGCC
AGGTGTGGCTGGGGCTCTCTTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6818794), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59774. Forward Primer - name:059774_F_IRAV117_e10_Stmn3, sequence:CTGAGCAAGGAGATCCGC; Reverse Primer - name:059774_R_SP6_IRAV117_e10_Stmn3, sequence:CTAAGAGAGCCCCAGCCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18233 same embryo
 EMAGE:18230 same embryo
 EMAGE:18229 same embryo
 EMAGE:18232 same embryo
 EMAGE:18228 same embryo
 EurExpress:euxassay_012016 same experiment
 MGI:4828509 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS