Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18240

Trim36 tripartite motif-containing 36 ( MGI:106264)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18240 EMAGE:18240 EMAGE:18240 EMAGE:18240 EMAGE:18240
"Pseudo-wholemount" of euxassay_012029. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012029_01 euxassay_012029_02 euxassay_012029_03 euxassay_012029_04
EMAGE:18240 EMAGE:18240 EMAGE:18240 EMAGE:18240 EMAGE:18240
euxassay_012029_05 euxassay_012029_06 euxassay_012029_07 euxassay_012029_08 euxassay_012029_09
EMAGE:18240 EMAGE:18240 EMAGE:18240 EMAGE:18240 EMAGE:18240
euxassay_012029_10 euxassay_012029_11 euxassay_012029_12 euxassay_012029_13 euxassay_012029_14
EMAGE:18240 EMAGE:18240 EMAGE:18240 EMAGE:18240 EMAGE:18240
euxassay_012029_15 euxassay_012029_16 euxassay_012029_17 euxassay_012029_18 euxassay_012029_19
EMAGE:18240 EMAGE:18240 EMAGE:18240 EMAGE:18240
euxassay_012029_20 euxassay_012029_21 euxassay_012029_22 euxassay_012029_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18240Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18240_wholemount_strong.wlz
18240_wholemount_moderate.wlz
18240_wholemount_weak.wlz
18240_wholemount_possible.wlz
18240_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18240_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 12 15 16 weak expression: see section 10 11 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 11 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 17
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 14 15 16 17 weak expression: see section 05 06 07 08 09 10 11 12 13
facial vii ganglion
strong strong
regionalstrong expression: see section 04 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17 weak expression: see section 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 17 18 19 20 21
vagus x ganglion
weak weak
regionalweak expression: see section 16
trigeminal v nerve
weak weak
regionalweak expression: see section 09 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 14 weak expression: see section 08 10 12 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 13 14 15 16 17
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 22 23 weak expression: see section 01
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 14 15 16 17
vomeronasal organ
weak weak
regionalweak expression: see section 12 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30686
Entity Detected:Trim36, tripartite motif-containing 36 ( MGI:106264)
Sequence:sense strand is shown

>T30686
GAGGGCGAAGGAAGAAGCGCTGGCGCATTTTGAAAAGCTCTTTGAAATCCTGGAAGACAGGAAGTCGTCT
GTTCTGAAAGCCATAGATGCCTCTAAGAAACTAAGACTAGACAAGTTTCACACTCAGATGGAAGAGTACC
AAGGCCTTCTAGAGAATAACGGGCTCGTGGGGTATGCTCAGGAAGTGCTGAAGGAGACGGATCAGTCTTG
CTTTGTGCAGACGGCGAAGCAGCTCCATCTCAGAATACAGAAAGCTACGGAGTCCCTGAAGAGCTTTAGA
CCTGCAGCCCAGGCTTCTTTTGAAGACTATGTTGTTAACATATCGAAACAAACAGAGGTGCTTGGAGAGT
TGTCCTTTTTCTCCAGTGGCATAGACATTCCTGAGATCAACGAGGAACAGAGTAAAGTGTATAATAACGC
CTTGATAGACTGGCATCATCCAGAAAAGGACAAAGCCGACAGCTATGTTCTAGAATACCGCAAGATTAAT
AGAGACGAAGAAATGATATCATGGAATGAGATAGAAGTTCACGGCACAAGTAAAGTTGTCTCCAACCTTG
AAAGCAACAGTCCCTATGCGTTCCGAGTGAGAGCTTACAGGGGTTCTATCTGCAGTCCCTGCAGCAGAGA
ATTGATCCTGCATACTCCTCCAGCTCCAGTTTTCAGTTTCCTGTTCGATGAGAAGTGTGGCTACAACACT
GAGCACCTCTTGCTGAACCTGAAGAGAGACCGGGTGGAGAGCAGAGCTGGATTTAACGTCCTCCTGGCTG
CGGAGCGCATCCAAGTGGGCCATTACACAAGCTTAGACTACATCATCGGGGATGTCGGAGTCACGAAAGG
TAAACACTTCTGGGCCTGCCGCGTGGAACCGTATTCATACCTGGTGAAAGTGGGAGTTGCTTCCAGCGAC
AAACTGCAAGAGTGGCTGCGCTCTCCCCGAGATGCAGCTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6836197), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59828. Forward Primer - name:059828_F_IRAV118_b09_Trim36, sequence:GAGGGCGAAGGAAGAAGC; Reverse Primer - name:059828_R_SP6_IRAV118_b09_Trim36, sequence:CTAGCTGCATCTCGGGGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18241 same embryo
 EurExpress:euxassay_012029 same experiment
 MGI:4828915 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS