Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18313

Haus4 HAUS augmin-like complex, subunit 4 ( MGI:1261794)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18313 EMAGE:18313 EMAGE:18313 EMAGE:18313 EMAGE:18313
"Pseudo-wholemount" of euxassay_012110. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012110_01 euxassay_012110_02 euxassay_012110_03 euxassay_012110_04
EMAGE:18313 EMAGE:18313 EMAGE:18313 EMAGE:18313 EMAGE:18313
euxassay_012110_05 euxassay_012110_06 euxassay_012110_07 euxassay_012110_08 euxassay_012110_09
EMAGE:18313 EMAGE:18313 EMAGE:18313 EMAGE:18313 EMAGE:18313
euxassay_012110_10 euxassay_012110_11 euxassay_012110_12 euxassay_012110_13 euxassay_012110_14
EMAGE:18313 EMAGE:18313 EMAGE:18313 EMAGE:18313 EMAGE:18313
euxassay_012110_15 euxassay_012110_16 euxassay_012110_17 euxassay_012110_18 euxassay_012110_19
EMAGE:18313 EMAGE:18313 EMAGE:18313
euxassay_012110_20 euxassay_012110_21 euxassay_012110_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18313Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18313_wholemount_strong.wlz
18313_wholemount_moderate.wlz
18313_wholemount_weak.wlz
18313_wholemount_possible.wlz
18313_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18313_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 14 15 16 17 18 19 20 moderate expression: see section 11 21 22
humerus
strong strong
regionalstrong expression: see section 01 02 18 19 21
forelimb digit 1 metacarpal
strong strong
regionalstrong expression: see section 01
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 01
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 07
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 07 08
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 07
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 07 08
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 06 07
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 06 07 08
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 08
fibula
strong strong
regionalstrong expression: see section 01 02 03 04
tibia
strong strong
regionalstrong expression: see section 01 02 03 04 05
femur
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 09 18 19 20 21 22
axial musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 15 16 17 18 19 20
otic capsule
strong strong
spottedstrong expression: see section 05 06 07 08
naris
strong strong
spottedstrong expression: see section 12 13 14 15 16 17
viscerocranium
strong strong
spottedExpression in the turbinate bone.
hyoid
strong strong
spottedstrong expression: see section 08 09 10 11 12 13 15
meckel's cartilage
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
cricoid cartilage
strong strong
spottedstrong expression: see section 10 11 12
thyroid cartilage
strong strong
spottedstrong expression: see section 09 10 11 12 13 14
axial skeleton
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
basioccipital bone
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
basisphenoid bone
strong strong
spottedstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
temporal bone petrous part
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 15 16 17 18 19 20 21 22
orbito-sphenoid
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 17 18 19 20 21 22
scapula
strong strong
regionalstrong expression: see section 01 02 19
sternum
strong strong
regionalstrong expression: see section 12
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 10 11 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30739
Entity Detected:Haus4, HAUS augmin-like complex, subunit 4 ( MGI:1261794)
Sequence:sense strand is shown

>T30739
AATCCGCGTTTCAGCAAGCTGTTGCTCAGTCTCTCCCAGCACGTGGATGAAAGTGGCTTGAGCCTCACGC
TGGCCAAGGAGCAGGCTCAGGCGTGGAGTGAAGTTCGGCATCGTAAGACAGCATGGCTGAGGTATGAGAT
CTTACAGAGAGTTATCCAAGAGCTGCTCGTGGACTACTATGTGAAGGCCCAAGACACAAACCTAACCTCC
GAAGACAAAAAGTTTCATGAGACCCTTGAACAGCGGCTGCTGGTAACTGAGCTGACGCAGCTCTCAGGTC
CTGGGCAGGAGACAGAGTTGCCCCCGCTGCTAGGTCTGGAGAGGACCGACCTTCTGGAGCTCATGCCACC
CTCCCAGGATTTCGTGTGGATGAAAGCCCGGCTCCAGCTGGAGGTGGAGGAGCAGCTCAAGAGGAAATGC
TTCACGCTGCTGTGCTACCATGACCCCAGTTCAGATACTGATGGAGACACACTGAAAGCAGCGAAGGTGT
GGACGCTGACAGAGGTCCTGGTCAGGGAGAAGCAGCACTGCCTGGAGGCCAAGAGCCAGCAGAAGGAGCA
GCTGGTACTCCTGGAGAAGAAGAGGACCACCTACTCCCAGGTGCTGCTTCGCTGCCTCGCTTTGCTGCAG
AGGCTTCTTCAGGAGCACCGGCTGCAGACCAAGTCCGAGCTAGACCGCATCAATGCCCAGTACCTGGAGC
TGAAGTGCAGTGCTATGATTCTTAGGTTGAGGATGGAGGAGCTGAAGGTCTTGTCTGACACTTACAACGC
TGAGAAAGTGGAAATGCATCGCCTCATCAGGGACCGTTTGGAGGGAGCCATCCGCCTCCAAGAGCAGGAC
CTGGAGAAGTCAAGACTAGTCCTGCACACCTATGAGGCCCTGGGAGAAGACTTTGAGAGCTTGGTAAGGG
AGTACACCCAGCTCAGACTGGCAGCCGACAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3157901), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 37435. Forward Primer - name:037435_F_IRAV01-03_E22_9430093H08Rik, sequence:AATCCGCGTTTCAGCAAG; Reverse Primer - name:037435_R_SP6_IRAV01-03_E22_9430093H08Rik, sequence:GTTGTCGGCTGCCAGTCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18316 same embryo
 EMAGE:18317 same embryo
 EMAGE:18315 same embryo
 EMAGE:18314 same embryo
 EMAGE:18312 same embryo
 EurExpress:euxassay_012110 same experiment
 MGI:4825328 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS