Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18316

March2 membrane-associated ring finger (C3HC4) 2 ( MGI:1925915)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18316 EMAGE:18316 EMAGE:18316 EMAGE:18316 EMAGE:18316
"Pseudo-wholemount" of euxassay_012105. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012105_01 euxassay_012105_02 euxassay_012105_03 euxassay_012105_04
EMAGE:18316 EMAGE:18316 EMAGE:18316 EMAGE:18316 EMAGE:18316
euxassay_012105_05 euxassay_012105_06 euxassay_012105_07 euxassay_012105_08 euxassay_012105_09
EMAGE:18316 EMAGE:18316 EMAGE:18316 EMAGE:18316 EMAGE:18316
euxassay_012105_10 euxassay_012105_11 euxassay_012105_12 euxassay_012105_13 euxassay_012105_14
EMAGE:18316 EMAGE:18316 EMAGE:18316 EMAGE:18316 EMAGE:18316
euxassay_012105_15 euxassay_012105_16 euxassay_012105_17 euxassay_012105_18 euxassay_012105_19
EMAGE:18316 EMAGE:18316 EMAGE:18316 EMAGE:18316 EMAGE:18316
euxassay_012105_20 euxassay_012105_21 euxassay_012105_22 euxassay_012105_23 euxassay_012105_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18316Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18316_wholemount_strong.wlz
18316_wholemount_moderate.wlz
18316_wholemount_weak.wlz
18316_wholemount_possible.wlz
18316_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18316_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 weak expression: see section 09 22
humerus
strong strong
homogeneousstrong expression: see section 01 02 03
forelimb digit 1 phalanx
strong strong
homogeneousstrong expression: see section 01 02 03
forelimb digit 2 phalanx
strong strong
homogeneousstrong expression: see section 01 02 03
hindlimb digit 2 phalanx
strong strong
homogeneousstrong expression: see section 07 08
hindlimb digit 3 phalanx
strong strong
homogeneousstrong expression: see section 07 08
hindlimb digit 4 phalanx
strong strong
homogeneousstrong expression: see section 07 08
fibula
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06
tibia
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06
femur
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
otic capsule
strong strong
homogeneousstrong expression: see section 05 06 07 08 09
viscerocranium
moderate moderate
homogeneousExpression in the turbinate bone.
meckel's cartilage
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 moderate expression: see section 09 10 11 12
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
axial skeleton
strong strong
regionalstrong expression: see section 05 06 07 08 moderate expression: see section 12 13
basioccipital bone
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 18 19 moderate expression: see section 20 21 22
basisphenoid bone
strong strong
homogeneousstrong expression: see section 05 06 07 08
temporal bone petrous part
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 moderate expression: see section 20 21 22 23 24
orbito-sphenoid
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 moderate expression: see section 20 21 22 23 24
clavicle
strong strong
homogeneousstrong expression: see section 05 06 07
scapula
strong strong
homogeneousstrong expression: see section 01 02 03
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30736
Entity Detected:March2, membrane-associated ring finger (C3HC4) 2 ( MGI:1925915)
Sequence:sense strand is shown

>T30736
CCCTGCCTTTTCCAAGGTTGTAGAGGCCACAGGGCTTGGGCCACCTCAATATGTAGCACAAGTGACTTCA
CGGGATGGCCGGCTGCTCTCAACTGTCATCCGGGCTTTGGATTCACAGAGTGACTGTCCCTTCTGCCGAA
TCTGCCACGAGGGAGCAAAGGGGAGAACTTGCTGTCCCCATGTGGCTGCACGGGCACACTGGGAGCTGTG
CACAAGAGCTGCCTGGAGAAATGGCTGTCTTCCTCCAACACCAGCTACTGTGAGCTGTGTCACACTGAGT
TTGCAGTGGAAAAGCGGCCCCGACCTCTCACAGAGTGGCTAAAGGACCCAGGGCCGCGCACTGAGAAGCG
AACACTGTGCTGTGACATGGTGTGCTTTGTGTTCATCACACCACTGGCTGCCATCTCAGGCTGGCTTTGC
CTGCGAGGGGCCCAGGACCACCTCCGTCTGCATAGCCGGCTGGAAGCTGTAGGTCTCATTGCCCTCACCA
TCGCCCTCTTTACCATCTATGTGCTCTGGACACTGGTCTCTTTCCGATACCATTGCCAGCTGTACTCGGA
ATGGAGGAAGACAAATCAGAAAGTCCGCCTGAAGATTCGGGAAGCAGATGGCTCCGAGGATCCACATCAC
TCCTTGCTGGCTACTGGACTCTTAAAAAAGGTGGCAGAGGAGACCCCTGTGTGAAGGCCTGGCTGGCAGG
GCTCAGAGGTAGTAGACAGACCAGAGTCAGATGGCAATGCAGCTGGCATTTGGAAAGATGGAGGCTGCCT
GACTTTTCATGCACAGCTATGATGCTTCTCAGGCCCGTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3484751), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 13589. Forward Primer - name:013589_F_IRAV01-03_B21_9530046H09Rik, sequence:CCCTGCCTTTTCCAAGGT; Reverse Primer - name:013589_R_SP6_IRAV01-03_B21_9530046H09Rik, sequence:CTACGGGCCTGAGAAGCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18317 same embryo
 EMAGE:18315 same embryo
 EMAGE:18314 same embryo
 EMAGE:18313 same embryo
 EMAGE:18312 same embryo
 EurExpress:euxassay_012105 same experiment
 MGI:4826102 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS