Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18317

Acot6 acyl-CoA thioesterase 6 ( MGI:1921287)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18317 EMAGE:18317 EMAGE:18317 EMAGE:18317 EMAGE:18317
"Pseudo-wholemount" of euxassay_012106. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012106_01 euxassay_012106_02 euxassay_012106_03 euxassay_012106_04
EMAGE:18317 EMAGE:18317 EMAGE:18317 EMAGE:18317 EMAGE:18317
euxassay_012106_05 euxassay_012106_06 euxassay_012106_07 euxassay_012106_08 euxassay_012106_09
EMAGE:18317 EMAGE:18317 EMAGE:18317 EMAGE:18317 EMAGE:18317
euxassay_012106_10 euxassay_012106_11 euxassay_012106_12 euxassay_012106_13 euxassay_012106_14
EMAGE:18317 EMAGE:18317 EMAGE:18317 EMAGE:18317 EMAGE:18317
euxassay_012106_15 euxassay_012106_16 euxassay_012106_17 euxassay_012106_18 euxassay_012106_19
EMAGE:18317 EMAGE:18317 EMAGE:18317 EMAGE:18317 EMAGE:18317
euxassay_012106_20 euxassay_012106_21 euxassay_012106_22 euxassay_012106_23 euxassay_012106_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18317Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18317_wholemount_strong.wlz
18317_wholemount_moderate.wlz
18317_wholemount_weak.wlz
18317_wholemount_possible.wlz
18317_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18317_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 05 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 01 02 03 04 06 07 08
humerus
moderate moderate
regionalmoderate expression: see section 01 21 22 23 24 weak expression: see section 02
forelimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 01
forelimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 01
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 07
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 07 08 09
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 07
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 07 08 09
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 07
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 07 08 09
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 07
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 07 08 09
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 09
tarsus
moderate moderate
regionalmoderate expression: see section 06 07
fibula
moderate moderate
regionalmoderate expression: see section 01 02 04 05
tibia
moderate moderate
regionalmoderate expression: see section 01 02 04 05 weak expression: see section 03
femur
moderate moderate
regionalmoderate expression: see section 01 02 05 06 08 09 20 21 22 23 24
otic capsule
moderate moderate
regionalmoderate expression: see section 05 06 07 08 16 17
naris
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18
nasal septum
moderate moderate
regionalmoderate expression: see section 15
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
hyoid
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 weak expression: see section 08 09
meckel's cartilage
strong strong
regionalstrong expression: see section 05 16 17 18 20 21 22 moderate expression: see section 01 02 03 04 06 07 08 09 10 11 12 13 14 15 19 23
arytenoid cartilage
moderate moderate
regionalmoderate expression: see section 12
cricoid cartilage
moderate moderate
regionalmoderate expression: see section 12
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 09 12 13 14 weak expression: see section 10 11
axial skeleton
moderate moderate
regionalmoderate expression: see section 05 09 10 11 12 13 14 15 16 17 18 weak expression: see section 06 07 08
basioccipital bone
moderate moderate
homogeneousmoderate expression: see section 01 04 05 06 07 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
moderate moderate
homogeneousmoderate expression: see section 02 03 05 06 07 08 09 10 11 12 13 14 15 16
temporal bone petrous part
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 18 19 20 21 22 23 24
vault of skull
moderate moderate
homogeneousmoderate expression: see section 01
orbito-sphenoid
moderate moderate
homogeneousmoderate expression: see section 01 02 03 05 06 07 08 19 20 21 22 23 24
clavicle
moderate moderate
regionalmoderate expression: see section 16 17 18 19 20 weak expression: see section 04 05 06
scapula
moderate moderate
regionalmoderate expression: see section 01 21 22
sternum
moderate moderate
regionalmoderate expression: see section 12
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 10 11 12 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30740
Entity Detected:Acot6, acyl-CoA thioesterase 6 ( MGI:1921287)
Sequence:sense strand is shown

>T30740
TCTCCACCCACCTACCCACCCGGTTCCTAAGCTCACAGCCTAGTCTATTTTTTGGTCCTGAATAGACTCC
ATGTAGGGTCTGTCACATAACTGTAACTTTAGTAACCTTGTCCCCACTCTCCAAATTCTCTCAATCTTCT
TTAAGAGTAAATTTTCTACCAAGTTTCCTTCCCTTTAAGACACCATGAATTCCTCAACTATATGCTGAAG
AGGGAGTGCAACTTGAAATCCACTAAATGCCAGCCACACGAGGGAGGGAGTACTGATAACTTATGCCTGT
AGTAAGAGTGACTTTTGCCTCCTTTCACATCAAACTTTCAAAGAGCCTTTAACCCACAAATGAAGACAAT
GTTCCCTAACCATTAAAGCGCACAAAAATGTTTACTACAAAACCTTTCCCTACCATAAACATGCTGGTGG
TGGTTTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3485583), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 13644. Forward Primer - name:013644_F_IRAV01-03_F23_4632408A20Rik, sequence:TCTCCACCCACCTACCCA; Reverse Primer - name:013644_R_SP6_IRAV01-03_F23_4632408A20Rik, sequence:TGAAAACCACCACCAGCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18316 same embryo
 EMAGE:18315 same embryo
 EMAGE:18314 same embryo
 EMAGE:18313 same embryo
 EMAGE:18312 same embryo
 EurExpress:euxassay_012106 same experiment
 MGI:4822927 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS