Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18398

Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 ( MGI:1926555)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18398 EMAGE:18398 EMAGE:18398 EMAGE:18398 EMAGE:18398
"Pseudo-wholemount" of euxassay_014356. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014356_01 euxassay_014356_02 euxassay_014356_03 euxassay_014356_04
EMAGE:18398 EMAGE:18398 EMAGE:18398 EMAGE:18398 EMAGE:18398
euxassay_014356_05 euxassay_014356_06 euxassay_014356_07 euxassay_014356_08 euxassay_014356_09
EMAGE:18398 EMAGE:18398 EMAGE:18398 EMAGE:18398 EMAGE:18398
euxassay_014356_10 euxassay_014356_11 euxassay_014356_12 euxassay_014356_13 euxassay_014356_14
EMAGE:18398 EMAGE:18398 EMAGE:18398 EMAGE:18398 EMAGE:18398
euxassay_014356_15 euxassay_014356_16 euxassay_014356_17 euxassay_014356_18 euxassay_014356_19
EMAGE:18398 EMAGE:18398 EMAGE:18398
euxassay_014356_20 euxassay_014356_21 euxassay_014356_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18398Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18398_wholemount_strong.wlz
18398_wholemount_moderate.wlz
18398_wholemount_weak.wlz
18398_wholemount_possible.wlz
18398_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18398_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 04 05 06 08 09 10 11 12 13 14 16 moderate expression: see section 03 22
radius
strong strong
regionalstrong expression: see section 01 03
ulna
strong strong
regionalstrong expression: see section 01
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 moderate expression: see section 22
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 07
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 07
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 07
fibula
strong strong
regionalstrong expression: see section 01 02 03
tibia
strong strong
regionalstrong expression: see section 01 02 03
femur
strong strong
regionalstrong expression: see section 01 02 03 05 06 07 21 22
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 16 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 17 18 19
trigeminal v nerve
strong strong
regionalstrong expression: see section 17
spinal cord
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 10
cervical ganglion
strong strong
regionalstrong expression: see section 09 17
otic capsule
strong strong
regionalstrong expression: see section 07 08 09 10 16
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 15 16 17 18 19
nasal septum
strong strong
regionalstrong expression: see section 14
viscerocranium
strong strong
regionalExpression in the turbinate bone.
vomeronasal organ
strong strong
regionalstrong expression: see section 13
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 22
axial skeleton
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 21 22
basisphenoid bone
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 21 22
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 21 22
clavicle
moderate moderate
regionalmoderate expression: see section 06
scapula
strong strong
regionalstrong expression: see section 03 04 05 moderate expression: see section 22
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 08 09 10 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31525
Entity Detected:Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2 ( MGI:1926555)
Sequence:sense strand is shown

>T31525
CCTTCCTCGGATCCTGGTATTGAGGCTGACTTGAGAAGCCACTCTAGTGGAGGCCACGAGGGTCGGCGAA
GCAGTCAGGAGCTCTCATCACCAGGCTCGGACTCTGAGGATGCAGGCGGCGCTCGCCTAGGGCGCATGAT
CTCGTCCATTTCGGAGACAGAGCTGGAACTTAGCAGCGACGGTGGCAGCAGCAGTGGCCGCTCATCACAT
CTCACCAACTCCATCGAGGAGGCTTCGTCCCCAGCCTCGGAGCCTGAGCCGGAGCCCGAGCCACTACATG
AACCTCCCCGCCGCCCTGCCTTCCTGCCTGTGGGCCAGGATGACACCAACAGCGAATACGAGTCGGGCTC
TGAGTCTGAGCCTGACCTGAGCGAGGATGCTGACTCTCCCTGGCTGCTCAGCAACCTGGTGAGCCGCATG
ATCTCTGAGGGCTCCTCGCCCATTCGTTGCCCTGGCCAGTGCTTATCTCCTGCCCCACGCCTGCCAGAAG
AGGCTGCGTCACAGGCCAACTCGGTACCCCAGGACTGCCAAGACCCTGAGGCAGGGCCCCACGTGGAGTT
GGTGGACATGGACACTCTTTGCGGGCCACCTCCGCCGGCGCCTGCCGCACCTCGGCTTGGTCCCGCGCAG
CCTGGGCCCTGCCTTTTCCTTAGTAACCCAACACGGGATACCATCACCCCGCTTTGGGCCACACCGGGAC
GCACTGCCCGCCCTGGCCGCTCCTGCTCTGCTGCCTGCTCGGAGGAGGAGGAGGAGGATGAGGAAGAGGA
CGAGGAGGATGAGGAGGATGCGGAGGACAGCGTGGTTCCCCCTGGCTCCAGGACTACAGGCTCTACTGCG
CCGCTGGATGCCTCGCTGGTGTACGATGCAGTTAAATACACACTAGTGGTGGATGAGCACACGCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5359447), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 27965. Forward Primer - name:027965_F_IRAV67-70_C05_Mapk8ip2, sequence:CCTTCCTCGGATCCTGGT; Reverse Primer - name:027965_R_SP6_IRAV67-70_C05_Mapk8ip2, sequence:CTGCGTGTGCTCATCCAC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18397 same embryo
 EMAGE:18400 same embryo
 EMAGE:18399 same embryo
 EMAGE:18396 same embryo
 EurExpress:euxassay_014356 same experiment
 MGI:4826095 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS