Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18407

Klk7 kallikrein related-peptidase 7 (chymotryptic, stratum corneum) ( MGI:1346336)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18407 EMAGE:18407 EMAGE:18407 EMAGE:18407 EMAGE:18407
"Pseudo-wholemount" of euxassay_014355. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014355_01 euxassay_014355_02 euxassay_014355_03 euxassay_014355_04
EMAGE:18407 EMAGE:18407 EMAGE:18407 EMAGE:18407 EMAGE:18407
euxassay_014355_05 euxassay_014355_06 euxassay_014355_07 euxassay_014355_08 euxassay_014355_09
EMAGE:18407 EMAGE:18407 EMAGE:18407 EMAGE:18407 EMAGE:18407
euxassay_014355_10 euxassay_014355_11 euxassay_014355_12 euxassay_014355_13 euxassay_014355_14
EMAGE:18407 EMAGE:18407 EMAGE:18407 EMAGE:18407 EMAGE:18407
euxassay_014355_15 euxassay_014355_16 euxassay_014355_17 euxassay_014355_18 euxassay_014355_19
EMAGE:18407 EMAGE:18407 EMAGE:18407 EMAGE:18407 EMAGE:18407
euxassay_014355_20 euxassay_014355_21 euxassay_014355_22 euxassay_014355_23 euxassay_014355_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18407Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18407_wholemount_strong.wlz
18407_wholemount_moderate.wlz
18407_wholemount_weak.wlz
18407_wholemount_possible.wlz
18407_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18407_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 02 03 04 05 06 07 08 09 10 11 13 18 19 20 21 22 23 24
radius
moderate moderate
regionalmoderate expression: see section 01
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 22 23 24
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 04 21
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 04 21
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 04 21
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 04 21
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 21
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 21
tarsus
moderate moderate
regionalmoderate expression: see section 22
fibula
moderate moderate
regionalmoderate expression: see section 01 02 03 23 24
tibia
moderate moderate
regionalmoderate expression: see section 01 02 03 23 24
femur
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 17 18 19 20 22 23 24
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
otic capsule
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 16 17 18 19 20
nasal septum
moderate moderate
regionalmoderate expression: see section 13
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 13 14 16 17 18 19 20 21 22 23 weak expression: see section 10 12
axial skeleton
moderate moderate
regionalmoderate expression: see section 12 16 17 weak expression: see section 09 10 11 13 14 15 18
basioccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 05 06 08 09 10 11 12 13 14 15 16 17
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 18 19 20 21 22 23 24
scapula
moderate moderate
regionalmoderate expression: see section 03 04 05 23 24
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 08 09 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31532
Entity Detected:Klk7, kallikrein related-peptidase 7 (chymotryptic, stratum corneum) ( MGI:1346336)
Sequence:sense strand is shown

>T31532
CAAAGCAGAGGGAAGGCACCCAGAGACAGCTCCACCTGTGCCCCAGGGAGCTGGAGGCGGTGCGGGGGCA
GGGGAGGTATAAAAGGGCCAGCCCTATAGAAGGCTGGAGACACTGGTCTCCGGATCAAGGACAGAGCCTC
GCCAAGTCACTCCCAGCTCTCTCATCTGGCAGTCCCTGAGCCACTGTCGCCGAGATGGGAGTCTGGCTCC
TTTCCCTGATAACTGTGCTGCTGTCTTTAGCCCTGGAAACCGCTGGACAAGGAGAAAGGATTATAGATGG
CTACAAATGTAAAGAAGGCTCGCACCCATGGCAGGTGGCTCTGCTCAAAGGCAATCAGCTTCACTGTGGA
GGGGTGCTGGTGGACAAATACTGGGTGCTCACAGCAGCCCACTGCAAAATGGGTCAGTACCAAGTACAGC
TGGGCAGTGATAAAATAGGGGACCAGAGTGCCCAGAAGATCAAGGCTACAAAGTCATTCCGGCACCCTGG
CTACTCCACAAAGACCCACGTCAATGACATCATGCTTGTGAGGTTGGATGAGCCAGTCAAGATGTCATCC
AAAGTGGAGGCAGTCCAGCTTCCTGAACACTGTGAACCCCCAGGGACGTCATGTACCGTCTCTGGATGGG
GCACCACAACCAGCCCAGACGTGACCTTTCCCTCGGATCTTATGTGCTCGGATGTGAAGCTCATCTCCTC
CAGGGAGTGCAAGAAGGTGTACAAGGACCTGCTGGGGAAAACCATGCTGTGTGCTGGCATTCCTGACTCT
AAGACCAACACGTGCAATGGTGACTCAGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5322691), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 31309. Forward Primer - name:031309_F_IRAV67-70_F22_Klk7, sequence:CAAAGCAGAGGGAAGGCA; Reverse Primer - name:031309_R_SP6_IRAV67-70_F22_Klk7, sequence:CCCCTGAGTCACCATTGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18408 same embryo
 EMAGE:18406 same embryo
 EurExpress:euxassay_014355 same experiment
 MGI:4825812 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS