Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18472

Actrt2 actin-related protein T2 ( MGI:1920603)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18472 EMAGE:18472 EMAGE:18472 EMAGE:18472 EMAGE:18472
euxassay_014418_01 euxassay_014418_02 euxassay_014418_03 euxassay_014418_04 euxassay_014418_05
EMAGE:18472 EMAGE:18472 EMAGE:18472 EMAGE:18472 EMAGE:18472
euxassay_014418_06 euxassay_014418_07 euxassay_014418_08 euxassay_014418_09 euxassay_014418_10
EMAGE:18472 EMAGE:18472 EMAGE:18472 EMAGE:18472 EMAGE:18472
euxassay_014418_11 euxassay_014418_12 euxassay_014418_13 euxassay_014418_14 euxassay_014418_15
EMAGE:18472 EMAGE:18472 EMAGE:18472 EMAGE:18472 EMAGE:18472
euxassay_014418_16 euxassay_014418_17 euxassay_014418_18 euxassay_014418_19 euxassay_014418_20
EMAGE:18472 EMAGE:18472 EMAGE:18472 EMAGE:18472
euxassay_014418_21 euxassay_014418_22 euxassay_014418_23 euxassay_014418_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18472Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18472_wholemount_strong.wlz
18472_wholemount_moderate.wlz
18472_wholemount_weak.wlz
18472_wholemount_possible.wlz
18472_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18472_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
humerus
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 21 22 23 24 weak expression: see section 04
fibula
moderate moderate
regionalmoderate expression: see section 23 24
tibia
moderate moderate
regionalmoderate expression: see section 23 24
femur
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 18 19 20 21 22
meckel's cartilage
strong strong
regionalstrong expression: see section 05 06 07 08 moderate expression: see section 03 04 09 10 13 14 15 16 17 18 19 20 21 weak expression: see section 12
liver lobe
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 09 10 11 12 13 14 15 16 17 18 19 20 21 22 weak expression: see section 06 07 08
axial skeleton
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 weak expression: see section 13 14 15 16
basioccipital bone
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15
basisphenoid bone
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15
exoccipital bone
moderate moderate
regionalmoderate expression: see section 02 04 weak expression: see section 05 06 07 21
temporal bone
moderate moderate
regionalmoderate expression: see section 02 03 04 weak expression: see section 22 23 24
vault of skull
moderate moderate
regionalmoderate expression: see section 02 weak expression: see section 01 21 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 17 weak expression: see section 01 05 11 15 16 18 19 20 21 22 23 24
viscerocranium
weak weak
regionalExpression in the turbinate bone.
scapula
moderate moderate
regionalmoderate expression: see section 03 04 21 22
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 07 08 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31895
Entity Detected:Actrt2, actin-related protein T2 ( MGI:1920603)
Sequence:sense strand is shown

>T31895
CATGCCCACTGGAAAAGGCCCTGGCGGATGACATCAAGGAGAAGCTGTGCTATGTGGCCCTGGAGCCTGA
GGAGGAGCTGTCTCGGCGGGCAGAAGATGTCTTGAGAGAGTACAAACTGCCCGACGGGAATGTCATTTAC
ATCGGAGACCAGCTGTACCAGGCTCCTGAGGTCCTGTTCTCACCAGACCAGTTGGGCACCCATGGTCCAG
GGCTGGCACAGATGGCATCTAACAGCATAACCAAGTGTGATGCTGACATACAGAAGACACTCTTTGGGGA
GATTGTCTTGTCGGGGGGAAGCACGCTGTTTCAGGGGCTGGATGACAGGCTCCTGAAAGAACTGGAACAG
CTGGCTTCCAAGGGGGTCCCCATCAAAATCACAGCGCCGCCCGACCGCTGGTTCTCTACGTGGATCGGGG
CCTCCATTGTCACGTCTCTGAGCAGCTTTAAGCAGATGTGGATCACTGCTGCAGACTTCAAAGAGTTTGG
AGTGTCCGTGGTCCAGAGGCGGTGCTTCTGAAGGGCTGCACAGTCCCAGTAGCTGCAGTGTCCCTTGCAA
GGGACACCCATGGGAAGAGAGCCTCTCCCATGGCCTTTAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6774723), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60901. Forward Primer - name:060901_F_IRAW4_a11_Arpm2, sequence:CATGCCCACTGGAAAAGG; Reverse Primer - name:060901_R_SP6_IRAW4_a11_Arpm2, sequence:TGCTAAAGGCCATGGGAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18470 same embryo
 EMAGE:18469 same embryo
 EMAGE:18468 same embryo
 EMAGE:18471 same embryo
 EMAGE:18467 same embryo
 EurExpress:euxassay_014418 same experiment
 MGI:4822962 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS