EMAGE mouse gene expression spatial database

EMAGE:18488

1110006O24Rik RIKEN cDNA 1110006O24 gene ( MGI:1913373)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_014434. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_014434_01	euxassay_014434_02	euxassay_014434_03	euxassay_014434_04

euxassay_014434_05	euxassay_014434_06	euxassay_014434_07	euxassay_014434_08	euxassay_014434_09

euxassay_014434_10	euxassay_014434_11	euxassay_014434_12	euxassay_014434_13	euxassay_014434_14

euxassay_014434_15	euxassay_014434_16	euxassay_014434_17	euxassay_014434_18	euxassay_014434_19

euxassay_014434_20	euxassay_014434_21	euxassay_014434_22	euxassay_014434_23	euxassay_014434_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T31919
Entity Detected:	1110006O24Rik, RIKEN cDNA 1110006O24 gene ( MGI:1913373)
Sequence:	sense strand is shown >T31919 CCGACGGAAGAGAGGTGACAACCGGCCGCAGGGCTGAAGCCTGGAGGTCAGCGCTGGGGAGGAAGTCGTC CCCCGAGCACCACGATCCCGGACGCCCGACCCCCTGGCGGAACGGGTAGCGGTTCCGGATTGGGATCCGT GGGGCGTATGCACCCTGCTCGCCAGCGCTTCTGCTCCTTCTGCCTCAGTTTTCCGGACGCAGCGCGGAGC CAGCCCCACGTTTTTTTCCAGTTGGAGCGGAAGCCCACCTGCCCGTCCCCGAGAGCTGTCGCTGCCATCG CCATCCTCCCTGCAGGTCTGCAGGGATTGC
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6741624), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 61275. Forward Primer - name:061275_F_IRAW5_e02_1110006O24Rik, sequence:CCGACGGAAGAGAGGTGA; Reverse Primer - name:061275_R_SP6_IRAW5_e02_1110006O24Rik, sequence:GGCAATCCCTGCAGACCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:18489 same embryo
	EMAGE:18493 same embryo
	EMAGE:18487 same embryo
	EMAGE:18490 same embryo
	EMAGE:18491 same embryo
	EMAGE:18492 same embryo
	EurExpress:euxassay_014434 same experiment
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source