Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18521

Slc9a9 solute carrier family 9 (sodium/hydrogen exchanger), member 9 ( MGI:2679732)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18521 EMAGE:18521 EMAGE:18521 EMAGE:18521 EMAGE:18521
"Pseudo-wholemount" of euxassay_014481. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014481_01 euxassay_014481_02 euxassay_014481_03 euxassay_014481_04
EMAGE:18521 EMAGE:18521 EMAGE:18521 EMAGE:18521 EMAGE:18521
euxassay_014481_05 euxassay_014481_06 euxassay_014481_07 euxassay_014481_08 euxassay_014481_09
EMAGE:18521 EMAGE:18521 EMAGE:18521 EMAGE:18521 EMAGE:18521
euxassay_014481_10 euxassay_014481_11 euxassay_014481_12 euxassay_014481_13 euxassay_014481_14
EMAGE:18521 EMAGE:18521 EMAGE:18521 EMAGE:18521 EMAGE:18521
euxassay_014481_15 euxassay_014481_16 euxassay_014481_17 euxassay_014481_18 euxassay_014481_19
EMAGE:18521 EMAGE:18521 EMAGE:18521 EMAGE:18521 EMAGE:18521
euxassay_014481_20 euxassay_014481_21 euxassay_014481_22 euxassay_014481_23 euxassay_014481_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18521Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18521_wholemount_strong.wlz
18521_wholemount_moderate.wlz
18521_wholemount_weak.wlz
18521_wholemount_possible.wlz
18521_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18521_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
strong strong
single cellstrong expression: see section 03 04 17 18
glossopharyngeal ix ganglion
strong strong
single cellstrong expression: see section 04 05 14 15
trigeminal v ganglion
strong strong
single cellstrong expression: see section 02 03 04 05 06 07 15 16 17 18 19 20
vestibulocochlear viii ganglion
strong strong
single cellstrong expression: see section 04 05 15
dorsal root ganglion
strong strong
single cellstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38012
Entity Detected:Slc9a9, solute carrier family 9 (sodium/hydrogen exchanger), member 9 ( MGI:2679732)
Sequence:sense strand is shown

>T38012
TACGTCAGGGAAGGATGAAGATCATTTTCAACACCAGGGAGCAGTGGAGCTACTCGCGTTTAATTTTTTG
CTCATCCTTACCATTTTAACAATCTGGTTATTTAAAAATCACCGATTCCGCTTCTTGCATGAGACTGGAG
GGGCGATGGTGTATGGCCTCATAATGGGACTAATTTTGCGATATGCCACAGCGCCGACTGATATTGATAG
TGGAACTGTCTACAACTGTGGGAACTTGTTCTTCAGCCCATCAACTCTACTAGTCAACATCACCGACCAA
GTTTATGAGTATAAGTACCAGAGAGAGATCAACCAGCACAATATCAGCCCCCACCAAGGCAACGCCATAC
TGGAGAAGATGACGTTTGACCCAGAAATCTTCTTCAACGTTTTGCTGCCTCCCATCATATTTCATGCAGG
ATACAGTCTGAAGAAGAGACACTTTTTTCAAAACTTGGGATCCATTTTAACATATGCCTTCTTGGGAACA
GCCATCTCCTGTGTGGTCATAGGGTTAATTATGTACGGCTTTGTGAAAGCCATGGTGCATGCTGGCCAGC
TGAAGAGCGGAGACTTCCACTTCACTGACTGTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 70587. Forward Primer - name:070587_F_cDNA_Slc9a9, sequence:TACGTCAGGGAAGGATGAAGAT; Reverse Primer - name:070587_N_SP6_cDNA_Slc9a9, sequence:AAACAGTCAGTGAAGTGGAAGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18522 same embryo
 EurExpress:euxassay_014481 same experiment
 MGI:4828291 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS