Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18533

Sh3rf2 SH3 domain containing ring finger 2 ( MGI:2444628)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18533 EMAGE:18533 EMAGE:18533 EMAGE:18533 EMAGE:18533
"Pseudo-wholemount" of euxassay_014477. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014477_01 euxassay_014477_02 euxassay_014477_03 euxassay_014477_04
EMAGE:18533 EMAGE:18533 EMAGE:18533 EMAGE:18533 EMAGE:18533
euxassay_014477_05 euxassay_014477_06 euxassay_014477_07 euxassay_014477_08 euxassay_014477_09
EMAGE:18533 EMAGE:18533 EMAGE:18533 EMAGE:18533 EMAGE:18533
euxassay_014477_10 euxassay_014477_11 euxassay_014477_12 euxassay_014477_13 euxassay_014477_14
EMAGE:18533 EMAGE:18533 EMAGE:18533 EMAGE:18533 EMAGE:18533
euxassay_014477_15 euxassay_014477_16 euxassay_014477_17 euxassay_014477_18 euxassay_014477_19
EMAGE:18533 EMAGE:18533 EMAGE:18533 EMAGE:18533 EMAGE:18533
euxassay_014477_20 euxassay_014477_21 euxassay_014477_22 euxassay_014477_23 euxassay_014477_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18533Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18533_wholemount_strong.wlz
18533_wholemount_moderate.wlz
18533_wholemount_weak.wlz
18533_wholemount_possible.wlz
18533_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18533_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
homogeneousstrong expression: see section 06 07 09 10 11 13 14 15 moderate expression: see section 08 12 16 17
telencephalon mantle layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 09 10 11 13 14 15 moderate expression: see section 08 12 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate mantle layer
strong strong
homogeneousstrong expression: see section 04 05 06 07 09 10 11 13 14 15 moderate expression: see section 12
medulla oblongata basal plate mantle layer
strong strong
homogeneousstrong expression: see section 04 05 06 07 09 10 11 13 14 15 moderate expression: see section 08 12
rest of cerebellum
strong strong
homogeneousstrong expression: see section 07
rest of cerebellum mantle layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 09 10 11 13 14 15 moderate expression: see section 12 16 17 18 19
pons mantle layer
strong strong
homogeneousstrong expression: see section 04 05 06 07 09 10 11 13 14 15 moderate expression: see section 08 12 16 17
midbrain mantle layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 09 10 11 13 14 15 16 moderate expression: see section 08 12
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 weak expression: see section 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 14
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 15 16
spinal cord mantle layer
strong strong
regionalstrong expression: see section 05 06 07 09 10 11 moderate expression: see section 08
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 12 13 14
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 23 weak expression: see section 22 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38001
Entity Detected:Sh3rf2, SH3 domain containing ring finger 2 ( MGI:2444628)
Sequence:sense strand is shown

>T38001
AGAGAGCCTGATGCTGACTACCAAATGCTCAAAGATGATCATGCATTAAGCTTCTTGGCCCGATTCTTCC
CATATATTTCTTCACAGTAGATAAGCAGGGAGCACGGAGAGACAGATAAAGGATGTGTATGGTATTATAG
ACTTTTCATCCTTCTTCTCAAAACAAAGTGTGCTTGGAGGGCACTTGACCAGGCAGCGGGTTTAGATCTC
TATTCTGCCTGTAACCCAGTATATTTTGTTCTCCTTGGTTCCTAGTCATGTGGGGAAGGGAACTAGTTTC
CCTTATGGGACAATGGAGGGGAGGGCAGAGGAGGGTGCTTCTTAGAGAACTGTTACCAAAGAAAGTGGAC
AGAGAAGAAAAGGGAGATAGGAGGAACAGAGGAGGAATGGTGCATGAAACAAATATGGACAAGAAGAAGC
TGAAAGGCGGGAAGAGTAGAGTTCTCAGGAAAGAATATAAACAGGTCTGGTTGAAGCAATGTTTACACTG
ACAGAAGGTGGGAAAAGGACCAGATTCTGCCGTGGAGAAAGGGTCAAAACTAGATGACTCCATCCAGATG
GGCTGGAAGGAGCAGGTCCAGCCAGGGTGCCTTGTGAACAGGGTGAGGGAGAGGTGGGAGGCAGCTCTGC
GAACCAGACAGCTCTGCAAACCAGGGCCACGATCTAAGACAGCCCATTAGCTCTCATTAAATGTAATTGT
TGTGACTTAACATTCATCACATGTCCATCTATGTGGACACTTTAATGCATAAATGCCGTTTGCTACTAAG
GCTGGGTGCCACTTAAAAAAAAAAAAAAAAGACAGGTCTAATTAGACGTTTCCTACAGGCAGTTCTTGTA
GGTCTCTGGATTGTGAACATACATCTCTTACCCACCCACACACTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 67817. Forward Primer - name:067817_F_cDNA_Sh3rf2, sequence:AGAGAGCCTGATGCTGACTACC; Reverse Primer - name:067817_N_SP6_cDNA_Sh3rf2, sequence:AAGTGTGTGGGTGGGTAAGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18528 same embryo
 EMAGE:18530 same embryo
 EMAGE:18529 same embryo
 EMAGE:18532 same embryo
 EMAGE:18531 same embryo
 EurExpress:euxassay_014477 same experiment
 MGI:4828045 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS