Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18578

Ttc9 tetratricopeptide repeat domain 9 ( MGI:1916730)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18578 EMAGE:18578 EMAGE:18578 EMAGE:18578 EMAGE:18578
"Pseudo-wholemount" of euxassay_014552. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014552_01 euxassay_014552_02 euxassay_014552_03 euxassay_014552_04
EMAGE:18578 EMAGE:18578 EMAGE:18578 EMAGE:18578 EMAGE:18578
euxassay_014552_05 euxassay_014552_06 euxassay_014552_07 euxassay_014552_08 euxassay_014552_09
EMAGE:18578 EMAGE:18578 EMAGE:18578 EMAGE:18578 EMAGE:18578
euxassay_014552_10 euxassay_014552_11 euxassay_014552_12 euxassay_014552_13 euxassay_014552_14
EMAGE:18578 EMAGE:18578 EMAGE:18578 EMAGE:18578 EMAGE:18578
euxassay_014552_15 euxassay_014552_16 euxassay_014552_17 euxassay_014552_18 euxassay_014552_19
EMAGE:18578 EMAGE:18578 EMAGE:18578 EMAGE:18578 EMAGE:18578
euxassay_014552_20 euxassay_014552_21 euxassay_014552_22 euxassay_014552_23 euxassay_014552_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18578Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18578_wholemount_strong.wlz
18578_wholemount_moderate.wlz
18578_wholemount_weak.wlz
18578_wholemount_possible.wlz
18578_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18578_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38605
Entity Detected:Ttc9, tetratricopeptide repeat domain 9 ( MGI:1916730)
Sequence:sense strand is shown

>T38605
CTACAAGGACAAGAAATTCCGCGAAGCCATCGGCAAATACCACCGGGCGTTGCTGGAGCTGAAGGGATTG
CTGCCGTCACAAGAGGAGCGGGACGCACGGCCAGCCTCCTCGGCAGGGGTTCCCAAATCCAGCCGCCTCT
CAGAGGAGCAGAGCAAGACGGTTGAAGCCATTGAGATCGACTGTTACAACAGCCTGGCAGCCTGCCTGCT
CCAGGCCGAGCTGGTAAATTATGAGCGAGTCAAGGAGTATTGCCTGAAGGTCCTGAAGAAGGAAGGAGAG
AACTTCAAAGCTCTTTACAGGTCTGGTGTGGCCTTCTATCATCTTGGGGACTATGATAAAGCTCTCTACT
ACCTAAAAGAAGCAAGGACCCGACAAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 149586. Forward Primer - name:149586_F_cDNA_Ttc9, sequence:CTACAAGGACAAGAAATTCCGC; Reverse Primer - name:149586_N_SP6_cDNA_Ttc9, sequence:GTTGTCGGGTCCTTGCTTCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18579 same embryo
 EMAGE:18577 same embryo
 EMAGE:18580 same embryo
 EurExpress:euxassay_014552 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS