Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18585

5330426P16Rik RIKEN cDNA 5330426P16 gene ( MGI:1915440)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18585 EMAGE:18585 EMAGE:18585 EMAGE:18585 EMAGE:18585
"Pseudo-wholemount" of euxassay_014537. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014537_01 euxassay_014537_02 euxassay_014537_03 euxassay_014537_04
EMAGE:18585 EMAGE:18585 EMAGE:18585 EMAGE:18585 EMAGE:18585
euxassay_014537_05 euxassay_014537_06 euxassay_014537_07 euxassay_014537_08 euxassay_014537_09
EMAGE:18585 EMAGE:18585 EMAGE:18585 EMAGE:18585 EMAGE:18585
euxassay_014537_10 euxassay_014537_11 euxassay_014537_12 euxassay_014537_13 euxassay_014537_14
EMAGE:18585 EMAGE:18585 EMAGE:18585 EMAGE:18585 EMAGE:18585
euxassay_014537_15 euxassay_014537_16 euxassay_014537_17 euxassay_014537_18 euxassay_014537_19
EMAGE:18585 EMAGE:18585 EMAGE:18585 EMAGE:18585 EMAGE:18585
euxassay_014537_20 euxassay_014537_21 euxassay_014537_22 euxassay_014537_23 euxassay_014537_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18585Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18585_wholemount_strong.wlz
18585_wholemount_moderate.wlz
18585_wholemount_weak.wlz
18585_wholemount_possible.wlz
18585_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18585_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thalamus mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 14 15 16
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 weak expression: see section 02 03
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 14 15
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 16 17
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 17
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38740
Entity Detected:5330426P16Rik, RIKEN cDNA 5330426P16 gene ( MGI:1915440)
Sequence:sense strand is shown

>T38740
CAGAGAAGGAAAGAAAGACCGAGGGGTTGAACCTGAACACGTGAAAGAGAATCCAAGGTAATTGGGGAAG
CATTGTCAAGAGCTCACTAGCTATTTAAGAAAAAAGCATCCCATGTATCTTAATAAATTTTGTCTGATTG
ATGGCTTTTTGATGGGCCAGAGAGGAGTGAGAGAGAGCCAGAGAGACACAGAGACAGGCAGACAGACAGC
AAGGAGGAGTTTTCTTCTCTATCAGCAGCTATCTCTGTGTGAGGGTTTCTCCCTTCAAATGTCAATTCTG
CCATCCCTGTAGGGAACCTGCTTGGTACTGCCACATCAGAGAAGCCTCGGGTAAGGAGACTGGATGCTTG
GAATCATGGATACTCAGAGCACTGTTAACAAAGAGCAGAGTCCAGTCTTCCAGAGTCATGACCTGAATCC
AAAGTTGAAAAGATCTGAGCAGTGTATAAACAGCCTGTCATAACCTGCATAATACATTTTTAGTCCTGAA
TAAATCTATTCACACTTCTTTCTATAATCATACTTATGTAGATAAGGTTGGCAGGAGGAAGGTGAAGTAT
ATTTGAAGGTATATGTTTATAACAGCTTTAACCTCAAGTCATGTTTATTTATAAGAGAAAACGACAGTGG
AATTTGGAAAATTAAGAAATGATTCTTACCAGACAGTGGTGGCACACACCTTGAATCCAGCACTTGGGAG
ATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 161452. Forward Primer - name:161452_F_cDNA_mCG129015.1, sequence:CAGAGAAGGAAAGAAAGACCGA; Reverse Primer - name:161452_N_SP6_cDNA_mCG129015.1, sequence:CATCTCCCAAGTGCTGGATTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18587 same embryo
 EMAGE:18588 same embryo
 EMAGE:18583 same embryo
 EMAGE:18584 same embryo
 EMAGE:18586 same embryo
 EurExpress:euxassay_014537 same experiment
 MGI:4822759 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS