Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18632

Rhoh ras homolog gene family, member H ( MGI:1921984)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18632 EMAGE:18632 EMAGE:18632 EMAGE:18632 EMAGE:18632
"Pseudo-wholemount" of euxassay_016513. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016513_01 euxassay_016513_02 euxassay_016513_03 euxassay_016513_04
EMAGE:18632 EMAGE:18632 EMAGE:18632 EMAGE:18632 EMAGE:18632
euxassay_016513_05 euxassay_016513_06 euxassay_016513_07 euxassay_016513_08 euxassay_016513_09
EMAGE:18632 EMAGE:18632 EMAGE:18632 EMAGE:18632 EMAGE:18632
euxassay_016513_10 euxassay_016513_11 euxassay_016513_12 euxassay_016513_13 euxassay_016513_14
EMAGE:18632 EMAGE:18632 EMAGE:18632 EMAGE:18632 EMAGE:18632
euxassay_016513_15 euxassay_016513_16 euxassay_016513_17 euxassay_016513_18 euxassay_016513_19
EMAGE:18632 EMAGE:18632 EMAGE:18632 EMAGE:18632 EMAGE:18632
euxassay_016513_20 euxassay_016513_21 euxassay_016513_22 euxassay_016513_23 euxassay_016513_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18632Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18632_wholemount_strong.wlz
18632_wholemount_moderate.wlz
18632_wholemount_weak.wlz
18632_wholemount_possible.wlz
18632_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18632_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
strong strong
regionalstrong expression: see section 18 19 moderate expression: see section 03 04
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 16
trigeminal v ganglion
strong strong
regionalstrong expression: see section 18 19 20 moderate expression: see section 03 04 05 06 07 08 16 17
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 15
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 16 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 13 14 15
neural retina
weak weak
regionalweak expression: see section 01 02 03 20 21 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 14 weak expression: see section 15
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38727
Entity Detected:Rhoh, ras homolog gene family, member H ( MGI:1921984)
Sequence:sense strand is shown

>T38727
ATCAGGAGCAACCTACCCTGTACCCCGGTGCTGGTTGTGGCCACACAGACGGACCAGAGAGAGGTGGGAC
CTCACAGGGCTTCCTGCATCAATGCCATAGAAGGGAAGAGACTTGCCCAGGATGTGAGAGCCAAGGGCTA
CCTGGAGTGCTCAGCCCTCAGCAACCGGGGAGTACAGCAGGTATTTGAATGTGCTGTCCGAACAGCTGTC
AACCAGGCCAGGAGGCGAAACAGAAGGAAGCTGTTCTCCATCAATGAATGCAAGATCTTCTAAACCCCAA
GGTCCTGTGCCCAACATTCATGAATGTATGAATGTACCTCAGAGACTCATAGGAGAGGGGAAAGGGCAAG
CCAAGAGGACTGATGCTCTGTCTTGAAACATCTGAACAAGCTTTCTGCATGGGGTTATGAGGGAGTCTGC
CGCTGCTGCTTCCACTAACTCTACTCTGCAGAAGAACTCTGTGCCCAGCACAACCAGAGAGATTCCTTGG
GAAGCCATATGAGTAGTCCATCTTCAATGAGAGACTAAAACAACCATCCTAATTTAGACAATGAAGTGCA
TTTCCCAACTATGCCATATTTAAATCCACATCTTATTTAAATAATAACCAAATATCGAGCTCTTGTTTTC
ATGCTTTGGAAGTCTTTTCTTTGAAAAGGCAAACTGCTGTATGAGGAGAAAATAACCTTGTGGGGTTCAA
CCATATGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 103982. Forward Primer - name:103982_F_cDNA_Rhoh, sequence:ATCAGGAGCAACCTACCCTGTA; Reverse Primer - name:103982_N_SP6_cDNA_Rhoh, sequence:ACATATGGTTGAACCCCACAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18633 same embryo
 EMAGE:18634 same embryo
 EMAGE:18635 same embryo
 EurExpress:euxassay_016513 same experiment
 MGI:4827734 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS