Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18635

Ranbp2 RAN binding protein 2 ( MGI:894323)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18635 EMAGE:18635 EMAGE:18635 EMAGE:18635 EMAGE:18635
"Pseudo-wholemount" of euxassay_016512. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016512_01 euxassay_016512_02 euxassay_016512_03 euxassay_016512_04
EMAGE:18635 EMAGE:18635 EMAGE:18635 EMAGE:18635 EMAGE:18635
euxassay_016512_05 euxassay_016512_06 euxassay_016512_07 euxassay_016512_08 euxassay_016512_09
EMAGE:18635 EMAGE:18635 EMAGE:18635 EMAGE:18635 EMAGE:18635
euxassay_016512_10 euxassay_016512_11 euxassay_016512_12 euxassay_016512_13 euxassay_016512_14
EMAGE:18635 EMAGE:18635 EMAGE:18635 EMAGE:18635 EMAGE:18635
euxassay_016512_15 euxassay_016512_16 euxassay_016512_17 euxassay_016512_18 euxassay_016512_19
EMAGE:18635 EMAGE:18635 EMAGE:18635 EMAGE:18635 EMAGE:18635
euxassay_016512_20 euxassay_016512_21 euxassay_016512_22 euxassay_016512_23 euxassay_016512_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18635Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18635_wholemount_strong.wlz
18635_wholemount_moderate.wlz
18635_wholemount_weak.wlz
18635_wholemount_possible.wlz
18635_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18635_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 09 10
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 14 weak expression: see section 09 10 11 13
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 14 moderate expression: see section 15 weak expression: see section 11 13
telencephalon mantle layer
strong strong
regionalstrong expression: see section 04 05 18 19 moderate expression: see section 03 weak expression: see section 20 21
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 05 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 16
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 16
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 13 14 15
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 14 moderate expression: see section 11 15 weak expression: see section 08 09 10 12 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38726
Entity Detected:Ranbp2, RAN binding protein 2 ( MGI:894323)
Sequence:sense strand is shown

>T38726
AGGATTTTCAGTCAGAGCTTCGAAAAGTCTGTGAAGCTCAGAAATCCCAGAATGAGAAAGTGACTGATAG
AGTTGGTATTGAGCATATAGGTGAGACTGAAGTAACAAACCCTGTTGGCTGTAAGTCTGAAGAACCTGAT
TCTGATACCAAACACAGTAGCTCATCCCCTGTTTCTGGGACTATGGACAAACCTGTCGATTTGTCCACTA
GAAAAGAAACTGACATGGAATTCCCAAGCAAAGGGGAAAACAAGCCTGTTTTGTTTGGATTTGGAAGTGG
TACAGGCCTGTCATTTGCAGACTTGGCTTCAAGTAATTCTGGAGATTTTGCTTTTGGCTCTAAAGATAAA
AATTTCCAGTGGGCAAATACTGGAGCAGCTGTGTTTGGAACACAGACAACAAGTAAAGGTGGCGAGGATG
AAGACGGCAGTGATGAAGATGTAGTTCATAATGAGGACATCCACTTTGAACCTATAGTCTCCTTACCAGA
GGTAGAAGTGAAATCTGGAGAGGAAGATGAAGAAGTTTTGTTCAAAGAGAGAGCCAAACTTTATAGGTGG
GACAGAGATGTCAGTCAGTGGAAGGAGAGAGGTATTGGAGATATAAAGATTCTCTGGCATACAATGAAGA
AGTATTATCGGATCCTAATGAGAAGAGACCAGGTTTTTAAAGTGTGTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 104842. Forward Primer - name:104842_F_cDNA_Ranbp2, sequence:AGGATTTTCAGTCAGAGCTTCG; Reverse Primer - name:104842_N_SP6_cDNA_Ranbp2, sequence:GCACACACTTTAAAAACCTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18633 same embryo
 EMAGE:18634 same embryo
 EMAGE:18632 same embryo
 EurExpress:euxassay_016512 same experiment
 MGI:4827605 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS