Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18688

Hoxd13 homeobox D13 ( MGI:96205)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18688 EMAGE:18688 EMAGE:18688 EMAGE:18688 EMAGE:18688
"Pseudo-wholemount" of euxassay_016606. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016606_01 euxassay_016606_02 euxassay_016606_03 euxassay_016606_04
EMAGE:18688 EMAGE:18688 EMAGE:18688 EMAGE:18688 EMAGE:18688
euxassay_016606_05 euxassay_016606_06 euxassay_016606_07 euxassay_016606_08 euxassay_016606_09
EMAGE:18688 EMAGE:18688 EMAGE:18688 EMAGE:18688 EMAGE:18688
euxassay_016606_10 euxassay_016606_11 euxassay_016606_12 euxassay_016606_13 euxassay_016606_14
EMAGE:18688 EMAGE:18688 EMAGE:18688 EMAGE:18688 EMAGE:18688
euxassay_016606_15 euxassay_016606_16 euxassay_016606_17 euxassay_016606_18 euxassay_016606_19
EMAGE:18688 EMAGE:18688 EMAGE:18688 EMAGE:18688 EMAGE:18688
euxassay_016606_20 euxassay_016606_21 euxassay_016606_22 euxassay_016606_23 euxassay_016606_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18688Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18688_wholemount_strong.wlz
18688_wholemount_moderate.wlz
18688_wholemount_weak.wlz
18688_wholemount_possible.wlz
18688_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18688_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 04 20
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 05 20
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 05 06 20
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 05 06 20
hindlimb digit 5 metatarsal
weak weak
regionalweak expression: see section 05 06 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45097
Entity Detected:Hoxd13, homeobox D13 ( MGI:96205)
Sequence:sense strand is shown

>T45097
TACAGCAGAACGCTCTCAAGTCGTCCCCGCACGCTTCTCTCGGAGGTTTCCCGGTGGAGAAGTACATGGA
CGTGTCGGGCCTGGCGAGCAGCAGCGTACCGACCAACGAGGTGCCCGCAAGAGCCAAGGAAGTGTCCTTC
TACCAGGGCTACACAAGTCCCTATCAGCACGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 166733. Forward Primer - name:166733_F_Hoxd13, sequence:TACAGCAGAACGCTCTCAAGTC; Reverse Primer - name:166733_R_SP6_Hoxd13, sequence:CACGTGCTGATAGGGACTTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18693 same embryo
 EMAGE:18690 same embryo
 EMAGE:18692 same embryo
 EMAGE:18691 same embryo
 EMAGE:18689 same embryo
 EurExpress:euxassay_016606 same experiment
 MGI:4825435 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS