Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18745

C330013J21Rik RIKEN cDNA C330013J21 gene ( MGI:1925953)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18745 EMAGE:18745 EMAGE:18745 EMAGE:18745 EMAGE:18745
"Pseudo-wholemount" of euxassay_014124. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014124_01 euxassay_014124_02 euxassay_014124_03 euxassay_014124_04
EMAGE:18745 EMAGE:18745 EMAGE:18745 EMAGE:18745 EMAGE:18745
euxassay_014124_05 euxassay_014124_06 euxassay_014124_07 euxassay_014124_08 euxassay_014124_09
EMAGE:18745 EMAGE:18745 EMAGE:18745 EMAGE:18745 EMAGE:18745
euxassay_014124_10 euxassay_014124_11 euxassay_014124_12 euxassay_014124_13 euxassay_014124_14
EMAGE:18745 EMAGE:18745 EMAGE:18745 EMAGE:18745 EMAGE:18745
euxassay_014124_15 euxassay_014124_16 euxassay_014124_17 euxassay_014124_18 euxassay_014124_19
EMAGE:18745 EMAGE:18745 EMAGE:18745 EMAGE:18745 EMAGE:18745
euxassay_014124_20 euxassay_014124_21 euxassay_014124_22 euxassay_014124_23 euxassay_014124_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18745Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18745_wholemount_strong.wlz
18745_wholemount_moderate.wlz
18745_wholemount_weak.wlz
18745_wholemount_possible.wlz
18745_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18745_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 07 08 16 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 16 17 18
spinal cord
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 13 14 15 16 17
neural retina
strong strong
regionalstrong expression: see section 01 02 22 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08
heart ventricle
strong strong
spottedstrong expression: see section 07 08 09 10 11 12 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40379
Entity Detected:C330013J21Rik, RIKEN cDNA C330013J21 gene ( MGI:1925953)
Sequence:sense strand is shown

>T40379
AGGGTAACTCAGGCAAGATCAGAACTTCAGACATGAATTTAGTCACCTATGATGACGTGCATATGAACTT
CACTCAGGAAGAGGGGGCTTTGCTTGAGACTTCTCAGAAGAATCTCTACAAAGATGTGATGCTAGAGACC
TATCGGAATCTCTCAGCTATAGGCAACTACACCAGGAACAATGTGAACCTGACTAATATTACCTGTGCTA
ATGAAAGACCCCCGAAGGGAGACCCTCACTCAAGCCTCGGGACAGCCGCGGACCCAAGAAGACACTGAGA
CCGAACTCAAAATGTTGAAGGCAAGATTTAATAAAGCAACAGCAAGAAAGCACATAGACCAGAGCTCTGG
GGTCGAAACTCATACACCTAGTGGTGTAGAGGAGAATCGACGACGAGCCAAATTTTTCACAGGCTTATAC
AGGAAAAACTCAAGGGGGGAGAGCGGGGCAGGGAAAGTACAAGTTTACATAACTAAGGGGTTCTGCCAAG
GGACAAGGGGTTCTGCCAAGGGATTCTACGTAACTAAGGGGTCATGTCCTATTATTTGGCAATGTACCCG
GTTCATTCTGAGGTTGTTCCAGGAGGCCCTTATCTCAAAAATGTTCTTGGAACAGTCTTTAGTTGGGAGG
GTTCGAACTCTAGGGTGAGGAGTTCAGGAATGCATTCTGGGGTGAAGAGTTCAGGAGTGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 77012. Forward Primer - name:077012_F_cDNA_C330013J21Rik, sequence:AGGGTAACTCAGGCAAGATCAG; Reverse Primer - name:077012_N_SP6_cDNA_C330013J21Rik, sequence:ACACTCCTGAACTCTTCACCCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18748 same embryo
 EMAGE:18744 same embryo
 EMAGE:18747 same embryo
 EMAGE:18746 same embryo
 EMAGE:18743 same embryo
 EurExpress:euxassay_014124 same experiment
 MGI:4823554 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS