Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18910

Agap1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 ( MGI:2653690)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18910 EMAGE:18910 EMAGE:18910 EMAGE:18910 EMAGE:18910
"Pseudo-wholemount" of euxassay_015873. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015873_01 euxassay_015873_02 euxassay_015873_03 euxassay_015873_04
EMAGE:18910 EMAGE:18910 EMAGE:18910 EMAGE:18910 EMAGE:18910
euxassay_015873_05 euxassay_015873_06 euxassay_015873_07 euxassay_015873_08 euxassay_015873_09
EMAGE:18910 EMAGE:18910 EMAGE:18910 EMAGE:18910 EMAGE:18910
euxassay_015873_10 euxassay_015873_11 euxassay_015873_12 euxassay_015873_13 euxassay_015873_14
EMAGE:18910 EMAGE:18910 EMAGE:18910 EMAGE:18910 EMAGE:18910
euxassay_015873_15 euxassay_015873_16 euxassay_015873_17 euxassay_015873_18 euxassay_015873_19
EMAGE:18910 EMAGE:18910 EMAGE:18910 EMAGE:18910 EMAGE:18910
euxassay_015873_20 euxassay_015873_21 euxassay_015873_22 euxassay_015873_23 euxassay_015873_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18910Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18910_wholemount_strong.wlz
18910_wholemount_moderate.wlz
18910_wholemount_weak.wlz
18910_wholemount_possible.wlz
18910_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18910_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
cerebellum
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
metencephalon basal plate
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 18 19
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 18 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 09 18
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 18 19
spinal cord mantle layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 10 17
cervical ganglion
weak weak
regionalweak expression: see section 10 17
thoracic ganglion
weak weak
regionalweak expression: see section 12 13 14
dorsal root ganglion
weak weak
regionalweak expression: see section 07 10 14 15 16 17 18
neural retina
weak weak
regionalweak expression: see section 02 03 04 05 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 11 12 13 14 16 17 18 19
vomeronasal organ
weak weak
regionalweak expression: see section 14 17
lower jaw incisor
weak weak
regionalweak expression: see section 13 14 17 18
lower jaw molar
weak weak
regionalweak expression: see section 09
upper jaw incisor
weak weak
regionalweak expression: see section 13 14 17 18
upper jaw molar
weak weak
regionalweak expression: see section 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63004
Entity Detected:Agap1, ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 ( MGI:2653690)
Sequence:sense strand is shown

>T63004
GGACTGTCATCCTACTTCTGGCACATGGGTCCCGGGACGAGGTGAATGAGACCTGTGGGGAAGGAGACGG
TCGCACGGCGCTGCACCTGGCCTGTCGCAAGGGCAACGTGGTCCTGGCTCAGCTGCTGATCTGGTACGGA
GTGGACGTCATGGCCCGAGACGCCCACGGGAACACAGCACTGGCCTATGCCCGGCAGGCCTCCAGCCAGG
AGTGTATTGACGTGCTTCTACAGTATGGCTGCCCCGACGAGCGCTTTGTGCTCATGGCTACCCCTAACCT
GTCCAGGAAGAGCAACAGCAGGAACAACAGTAGCGGGAGGGCGCCCAGTGTCATCTGAGCTCAGCCAACA
CTACACCTGGGATCCCACACCCACCTGCTCCAGAAGTTGCAACCACCACGTGAGTCCCTCAGTTCCCTCC
CTCTTCCAGGTGGAAGCCTTCCACCCACCTGCCACTCACTCACCCCACATGAAATCTCCAGACCTGGACA
TCCTCAAGGGGAGAAGAGGAGGCTGCAGGCCACAGGACGGAACTCTTTCCCCACCCTCCGGAAGCAACGT
AGGAGGACCGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93954. Forward Primer - name:093954_F_cDNA_Centg2, sequence:GGACTGTCATCCTACTTCTGGC; Reverse Primer - name:093954_N_SP6_cDNA_Centg2, sequence:GTCGGTCCTCCTACGTTGCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18911 same embryo
 EMAGE:18912 same embryo
 EMAGE:18913 same embryo
 EurExpress:euxassay_015873 same experiment
 MGI:4823024 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS