Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18937

Col4a5 collagen, type IV, alpha 5 ( MGI:88456)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18937 EMAGE:18937 EMAGE:18937 EMAGE:18937 EMAGE:18937
"Pseudo-wholemount" of euxassay_015894. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015894_01 euxassay_015894_02 euxassay_015894_03 euxassay_015894_04
EMAGE:18937 EMAGE:18937 EMAGE:18937 EMAGE:18937 EMAGE:18937
euxassay_015894_05 euxassay_015894_06 euxassay_015894_07 euxassay_015894_08 euxassay_015894_09
EMAGE:18937 EMAGE:18937 EMAGE:18937 EMAGE:18937 EMAGE:18937
euxassay_015894_10 euxassay_015894_11 euxassay_015894_12 euxassay_015894_13 euxassay_015894_14
EMAGE:18937 EMAGE:18937 EMAGE:18937 EMAGE:18937 EMAGE:18937
euxassay_015894_15 euxassay_015894_16 euxassay_015894_17 euxassay_015894_18 euxassay_015894_19
EMAGE:18937 EMAGE:18937 EMAGE:18937 EMAGE:18937 EMAGE:18937
euxassay_015894_20 euxassay_015894_21 euxassay_015894_22 euxassay_015894_23 euxassay_015894_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18937Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18937_wholemount_strong.wlz
18937_wholemount_moderate.wlz
18937_wholemount_weak.wlz
18937_wholemount_possible.wlz
18937_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18937_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
strong strong
regionalstrong expression: see section 10 moderate expression: see section 08 09 16 17
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 18
thyroid gland
moderate moderate
regionalmoderate expression: see section 10 11 15
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 12 13 14
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 12 13 14
diencephalon meninges
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
telencephalon meninges
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 21 22 weak expression: see section 02 03 23 24
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 10
hindbrain meninges
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 21 weak expression: see section 03
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 12 13
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 21 weak expression: see section 08 09 10 11 14 15 16 17 18 19 20
pons ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 14 15 16 17
midbrain meninges
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain floor plate
moderate moderate
regionalmoderate expression: see section 13
midbrain ventricular layer
weak weak
regionalweak expression: see section 09 10 11 14 15 16
spinal cord floor plate
weak weak
regionalweak expression: see section 11 12
spinal cord meninges
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
lens
strong strong
regionalstrong expression: see section 01
stomach
weak weak
regionalweak expression: see section 01 02 03 04 05 06
bladder
weak weak
regionalweak expression: see section 11 12 13
male reproductive system
moderate moderate
regionalmoderate expression: see section 03 04 05 06 18 19 20 weak expression: see section 07 17
urethra of male
weak weak
regionalweak expression: see section 12 13
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22
umbilical artery extraembryonic part
moderate moderate
regionalmoderate expression: see section 10 11
umbilical vein extraembryonic part
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63117
Entity Detected:Col4a5, collagen, type IV, alpha 5 ( MGI:88456)
Sequence:sense strand is shown

>T63117
TACCTGGCCAGAAAGGAAGTAAAGGAGAGCCTGGGGTTTCAGGCATTGGACTTCCAGGTCTTCCTGGCCC
AAAGGGTGAACCTGGTCTGCCTGGATATCCAGGAAACCCAGGTATCAAAGGGTCGGTGGGAGAGACTGGT
CTTCCTGGATTACCAGGAAACCCTGGAGCAAAAGGTCAACCGGGCCTGCCTGGATTCCCAGGAACACCAG
GACTTCCTGGACCAAAAGGTATGAATGGTCCTCCTGGTAACCCTGGCTTTCCCGGAGAACCTGGTCCTGT
AGGTGCCGGAGGGCGTCCTGGACCACCAGGACCTCCTGGTGAAAAAGGCAAGCCAGGTCAAGATGGCATT
CCTGGGCCAGCAGGACAAAAGGGAGAACCAGGTCAACCAGGCTTTGGAATCCCAGGACCTCCTGGACTCC
CAGGACTTTCTGGACAAAAGGGTGATGGAGGATCACCTGGACTTCCAGGAAATCCTGGCCTTCCAGGTTC
AAAGGGTGAGCCAGGCTTTCAGGGATTCCCTGGTATGCCAGGTCCCCCAGGTCCTCCTGGTTCTCCTGGT
CAAGCTTTGGAAGGTCCCAAAGGAAACCCTGGGCCTCAAGGCCCTCCTGGGAGACCAGGTCCTCCAGGTT
TTCAAGGTCCACCAGGTACAGAAGGTCCTCGTGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89511. Forward Primer - name:089511_F_cDNA_Col4a5, sequence:TACCTGGCCAGAAAGGAAGTAA; Reverse Primer - name:089511_N_SP6_cDNA_Col4a5, sequence:TCCACGAGGACCTTCTGTACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18938 same embryo
 EMAGE:18940 same embryo
 EMAGE:18939 same embryo
 EMAGE:18941 same embryo
 EMAGE:18936 same embryo
 EurExpress:euxassay_015894 same experiment
 MGI:4823992 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS