Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18986

Zfp870 zinc finger protein 870 ( MGI:3029586)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18986 EMAGE:18986 EMAGE:18986 EMAGE:18986 EMAGE:18986
"Pseudo-wholemount" of euxassay_015921. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015921_01 euxassay_015921_02 euxassay_015921_03 euxassay_015921_04
EMAGE:18986 EMAGE:18986 EMAGE:18986 EMAGE:18986 EMAGE:18986
euxassay_015921_05 euxassay_015921_06 euxassay_015921_07 euxassay_015921_08 euxassay_015921_09
EMAGE:18986 EMAGE:18986 EMAGE:18986 EMAGE:18986 EMAGE:18986
euxassay_015921_10 euxassay_015921_11 euxassay_015921_12 euxassay_015921_13 euxassay_015921_14
EMAGE:18986 EMAGE:18986 EMAGE:18986 EMAGE:18986 EMAGE:18986
euxassay_015921_15 euxassay_015921_16 euxassay_015921_17 euxassay_015921_18 euxassay_015921_19
EMAGE:18986 EMAGE:18986 EMAGE:18986 EMAGE:18986 EMAGE:18986
euxassay_015921_20 euxassay_015921_21 euxassay_015921_22 euxassay_015921_23 euxassay_015921_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18986Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18986_wholemount_strong.wlz
18986_wholemount_moderate.wlz
18986_wholemount_weak.wlz
18986_wholemount_possible.wlz
18986_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18986_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forebrain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hindbrain
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 17
spinal cord
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 13 14 15 16 17
neural retina
weak weak
regionalweak expression: see section 02 03 04 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63406
Entity Detected:Zfp870, zinc finger protein 870 ( MGI:3029586)
Sequence:sense strand is shown

>T63406
GGCAGTTACATTAGGTGCATGATTTAGTGGGTGAGTATGGCTGTGATAAACACCACAAGCCAAACGAGTG
GGGAGACAGGGTTCATCTGGCTTTATACTTCAAAATCACAGTGCATCATCAAAGGGAGTCGGGACAGGAA
CTCAGACAGGGCAGGAAGCTGGAGGCTGATGCAGAGGCTACGGAGGGGAGCTGCTTACTACTGCTTGCTC
ACACTGCCTTGTTCAACCTGCTTTCTTACAGAATCCAGGACCACCAGCCCAGGGATAGCACCATCTATAA
TGGACTGGGCCCTCCCCCCATCAGTCACAAATCGAGAAAATGCTCTACAGCCTTGCGTTCAGCCCGGTTT
TGAAGCATTTTCTCAATGTTGGTTCCCTCTTCTCAAATGACTCTAGCCTGTGTCAAGTTGTCACAAGTAA
CCAGTACAGTGCAGGAGCCCACGAAAGGAAAACTAGACAGCAGGGCCTGTGTATGACTCGCCAACCTGTC
AAGACCAGCTTTGTTTCCCAAATGTGCTCAGGTTGGCAATCTCATACCCAGAATCAAGCCTTCCTGTTTA
TTTTTTCAGTGTCCTTCACCTCACCATAGTCAACATTTTAAAACATTTTTATTTTTATATATTTATGTAT
AGGTATGACACATTTTCAATTTTTTTATACTTATATGTGTGAGTATGGACATGTGTGACGGTAACCCGAG
TCCAGAAAGCCATTAGATGCCTTATGAGTATTGCTTCTCAACCTGTGGGTTGGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 75167. Forward Primer - name:075167_F_cDNA_BC066107, sequence:GGCAGTTACATTAGGTGCATGA; Reverse Primer - name:075167_N_SP6_cDNA_BC066107, sequence:ACCAACCCACAGGTTGAGAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18984 same embryo
 EMAGE:18988 same embryo
 EMAGE:18985 same embryo
 EMAGE:18987 same embryo
 EMAGE:18983 same embryo
 EurExpress:euxassay_015921 same experiment
 MGI:4829345 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS