Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18998

Capn2 calpain 2 ( MGI:88264)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18998 EMAGE:18998 EMAGE:18998 EMAGE:18998 EMAGE:18998
"Pseudo-wholemount" of euxassay_015893. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015893_01 euxassay_015893_02 euxassay_015893_03 euxassay_015893_04
EMAGE:18998 EMAGE:18998 EMAGE:18998 EMAGE:18998 EMAGE:18998
euxassay_015893_05 euxassay_015893_06 euxassay_015893_07 euxassay_015893_08 euxassay_015893_09
EMAGE:18998 EMAGE:18998 EMAGE:18998 EMAGE:18998 EMAGE:18998
euxassay_015893_10 euxassay_015893_11 euxassay_015893_12 euxassay_015893_13 euxassay_015893_14
EMAGE:18998 EMAGE:18998 EMAGE:18998 EMAGE:18998 EMAGE:18998
euxassay_015893_15 euxassay_015893_16 euxassay_015893_17 euxassay_015893_18 euxassay_015893_19
EMAGE:18998 EMAGE:18998 EMAGE:18998 EMAGE:18998
euxassay_015893_20 euxassay_015893_21 euxassay_015893_22 euxassay_015893_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18998Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18998_wholemount_strong.wlz
18998_wholemount_moderate.wlz
18998_wholemount_weak.wlz
18998_wholemount_possible.wlz
18998_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18998_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 09 10
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 15
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 10 11
pons mantle layer
weak weak
regionalweak expression: see section 07 16
spinal cord floor plate
moderate moderate
regionalmoderate expression: see section 08 09 10 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63249
Entity Detected:Capn2, calpain 2 ( MGI:88264)
Sequence:sense strand is shown

>T63249
TTCAGCATCGAGACCTGTAAGATCATGGTGGACATGCTGGATGAAGATGGGAGTGGCAAGCTTGGCCTGA
AGGAGTTCTACATCCTCTGGACGAAGATTCAGAAATACCAAAAAATCTACCGGGAAATCGATGTGGACAG
GTCTGGAACCATGAATTCCTACGAGATGCGGAAAGCACTGGAAGAAGCAGGTTTCAAGCTGCCCTGTCAA
CTTCATCAAGTCATCGTTGCCCGGTTTGCAGACGACGAGCTAATCATCGACTTTGACAATTTTGTGCGGT
GTTTGGTCCGTCTGGAAACGCTATTCAAGATATTCAAGCAGCTAGACCCTGAGAACACTGGGACGATACA
GCTCAACCTTGCTTCGTGGCTGAGTTTTTCAGTACTCTGAAGTTACATGCCTGGAGAGGTCTAGTGGGAG
AAAACAACCAATGACTACACTTAGACACTTTGTATCTGGACCTTGAACTTACGGGAACATTGACTTCATC
GGATGATTATAACTGAAGAATATAACCGTCTGGGATAGATGAACTTTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89786. Forward Primer - name:089786_F_cDNA_Capn2, sequence:TTCAGCATCGAGACCTGTAAGA; Reverse Primer - name:089786_N_SP6_cDNA_Capn2, sequence:GAAAAGTTCATCTATCCCAGACG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18993 same embryo
 EMAGE:18996 same embryo
 EMAGE:18997 same embryo
 EMAGE:18995 same embryo
 EMAGE:18994 same embryo
 EurExpress:euxassay_015893 same experiment
 MGI:4823616 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS