Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19017

Smc4 structural maintenance of chromosomes 4 ( MGI:1917349)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19017 EMAGE:19017 EMAGE:19017 EMAGE:19017 EMAGE:19017
"Pseudo-wholemount" of euxassay_015934. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015934_01 euxassay_015934_02 euxassay_015934_03 euxassay_015934_04
EMAGE:19017 EMAGE:19017 EMAGE:19017 EMAGE:19017 EMAGE:19017
euxassay_015934_05 euxassay_015934_06 euxassay_015934_07 euxassay_015934_08 euxassay_015934_09
EMAGE:19017 EMAGE:19017 EMAGE:19017 EMAGE:19017 EMAGE:19017
euxassay_015934_10 euxassay_015934_11 euxassay_015934_12 euxassay_015934_13 euxassay_015934_14
EMAGE:19017 EMAGE:19017 EMAGE:19017 EMAGE:19017 EMAGE:19017
euxassay_015934_15 euxassay_015934_16 euxassay_015934_17 euxassay_015934_18 euxassay_015934_19
EMAGE:19017 EMAGE:19017 EMAGE:19017 EMAGE:19017 EMAGE:19017
euxassay_015934_20 euxassay_015934_21 euxassay_015934_22 euxassay_015934_23 euxassay_015934_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19017Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19017_wholemount_strong.wlz
19017_wholemount_moderate.wlz
19017_wholemount_weak.wlz
19017_wholemount_possible.wlz
19017_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19017_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 15 16 17 18 weak expression: see section 08 09
vibrissa
weak weak
regionalweak expression: see section 04 05 06 19 20 21
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 16
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 07 08 09 10 11 12 13 17 18 19 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 17 18 weak expression: see section 10 11 12 14 15 16
vomeronasal organ
weak weak
regionalweak expression: see section 10 14
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 13 14 weak expression: see section 11
lower jaw molar
weak weak
regionalweak expression: see section 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 14 weak expression: see section 11 15
upper jaw molar
weak weak
regionalweak expression: see section 17 18 19
liver
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
metanephros
weak weak
regionalweak expression: see section 07 08 09 11 16 17 18 19 20
lung
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63345
Entity Detected:Smc4, structural maintenance of chromosomes 4 ( MGI:1917349)
Sequence:sense strand is shown

>T63345
CTGCTGGAAGAAAATGTCAGTGTTTTCAAAAAAGAATATGATGCTGTGGCTGAGAAAGCTGGTAAAGTTG
AAGCTGAGATTAAACGGCTACACAATACCATCATAGATATCAACAACCGAAAACTCAAGGCCCAGCAAAA
CAAACTTGACACGATAAATAAGCAGCTTGATGAATGTGCTTCTGCTATTACTAAGGCCCAAGTAGCAATC
AAGACTGCTGACAGAAATCTTAAAAAGGCACAGGATTCTGTTTGCCGCACAGAGAAAGAAATAAAAGACA
CTGAAAAAGAAATAAATGACTTAAAGACAGAGCTAAAAAATATTGAAGACAAGGCAGAAGAGGTCATAAA
CAATACAAAAACTGCAGAGACATCCTTACCAGAAATCCAGAAAGAACATCGTAATCTACTTCAGGAACTA
AAAGTTATTCAAGAAAATGAACATGCTCTTCAGAAAGATGCACTTAGTATTAAGTTGAAACTTGAACAGA
TAGATGGCCACATTTCTGAACATAACTCAAAAATAAAATACTGGCAAAAAGAGATTTCAAAAATAAAATT
GCATCCTGTTGAAGATAATCCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96309. Forward Primer - name:096309_F_cDNA_Smc4l1, sequence:CTGCTGGAAGAAAATGTCAGTG; Reverse Primer - name:096309_N_SP6_cDNA_Smc4l1, sequence:CAGGATTATCTTCAACAGGATGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19014 same embryo
 EMAGE:19015 same embryo
 EMAGE:19019 same embryo
 EMAGE:19016 same embryo
 EMAGE:19018 same embryo
 EurExpress:euxassay_015934 same experiment
 MGI:4828327 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS