Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19052

Lrrn3 leucine rich repeat protein 3, neuronal ( MGI:106036)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19052 EMAGE:19052 EMAGE:19052 EMAGE:19052 EMAGE:19052
"Pseudo-wholemount" of euxassay_015911. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015911_01 euxassay_015911_02 euxassay_015911_03 euxassay_015911_04
EMAGE:19052 EMAGE:19052 EMAGE:19052 EMAGE:19052 EMAGE:19052
euxassay_015911_05 euxassay_015911_06 euxassay_015911_07 euxassay_015911_08 euxassay_015911_09
EMAGE:19052 EMAGE:19052 EMAGE:19052 EMAGE:19052 EMAGE:19052
euxassay_015911_10 euxassay_015911_11 euxassay_015911_12 euxassay_015911_13 euxassay_015911_14
EMAGE:19052 EMAGE:19052 EMAGE:19052 EMAGE:19052 EMAGE:19052
euxassay_015911_15 euxassay_015911_16 euxassay_015911_17 euxassay_015911_18 euxassay_015911_19
EMAGE:19052 EMAGE:19052 EMAGE:19052
euxassay_015911_20 euxassay_015911_21 euxassay_015911_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19052Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19052_wholemount_strong.wlz
19052_wholemount_moderate.wlz
19052_wholemount_weak.wlz
19052_wholemount_possible.wlz
19052_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19052_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal medulla
weak weak
regionalweak expression: see section 09 10 11 16 17
pituitary gland
weak weak
regionalweak expression: see section 10 11 12 13 14
vibrissa
moderate moderate
regionalmoderate expression: see section 01 02 03 16 18 weak expression: see section 15 17 19
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
olfactory cortex mantle layer
strong strong
regionalstrong expression: see section 06 07 08 11 12
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate marginal layer
moderate moderate
regionalmoderate expression: see section 17
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 19 20 moderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 17
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 07 15 16 17 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 06 07 08 16 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 07 14
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 10 15
cervical ganglion
weak weak
regionalweak expression: see section 08 09 15
thoracic ganglion
weak weak
regionalweak expression: see section 12 13
ear
weak weak
regionalweak expression: see section 22
inner ear vestibular component
weak weak
regionalweak expression: see section 01 02 03 05 06 18 19 20 21
neural retina
weak weak
regionalweak expression: see section 01 19 20 21 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 12 13 14
stomach
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08
lower lip
weak weak
regionalweak expression: see section 06 15 16 17
upper lip
moderate moderate
regionalmoderate expression: see section 02 03 17 18
trachea
weak weak
regionalweak expression: see section 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63237
Entity Detected:Lrrn3, leucine rich repeat protein 3, neuronal ( MGI:106036)
Sequence:sense strand is shown

>T63237
CAGTCTCGCTGTGGATAACTTGCCAGATTTGAGAAAAATAGAAGCTACTAACAACCCCAGATTGTCTTAC
ATTCACCCTAATGCATTTTTCAGACTCCCAAAGCTAGAATCTCTCATGCTGAACACCAACGCCCTCAGTG
CCCTCTACCACGGCACCATAGAGTCTTTGCCGAACCTCAAGGAAATCAGCATACATAGCAATCCCATCCG
TTGCGACTGTGTAATCCGCTGGATTAACATGAACAAAACCAACATTCGGTTTATGGAACCAGACTCGCTG
TTCTGTGTGGACCCACCTGAATTCCAAGGCCAGAATGTTCGGCAAGTGCATTTCAGGGATATGATGGAAA
TTTGCCTCCCTCTTATAGCTCCTGAGAGCTTTCCTTCTGACCTGGATGTAGAAGCTGACAGCTATGTGTC
GCTTCACTGCAGAGCTACTGCAGAACCCCAGCCAGAAATCTACTGGATCACACCTTCTGGTAAAAAACTA
TTGCCAAATACAATGAGAGAGAAGTTCTATGTTCATTCTGAAGGCACACTAGAGATAAGAGGCATAACCC
CAAAGGAAGGGGGGTTGTACACCTGCATAGCAACTAACCTAGTCGGTGCTGATTTGAAGTCGATTATGAT
CAAAGTGGGAGGTTCTGTTCCTCAGGATAATAATGGGTCATTGAATATTAAAATAAGAGATATCAGGGCC
AATTCTGTTCTGGTGTCCTGGAAAGCGAGCTCTAAAATCCTCAAATCCAGCGTTAAGTGGACAGCCTTTG
TCAAGACTGAAGACTCTCATGCTGCCCAAAGTGCTCGAATACCATTTGATGTCAAGGTATATAATCTTAC
TCATCTGAAACCATCTACCGAGTACAAAATTTGTATTGATATTCCCACCGTCTATCAGAAAAGCAGAAAA
CAATGTGTGAATGTCACCACAAAAAGTCTGGAGCATGACGGAAAAGAATATGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 73182. Forward Primer - name:073182_F_cDNA_Lrrn3, sequence:CAGTCTCGCTGTGGATAACTTG; Reverse Primer - name:073182_N_SP6_cDNA_Lrrn3, sequence:CCATATTCTTTTCCGTCATGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19056 same embryo
 EMAGE:19051 same embryo
 EMAGE:19053 same embryo
 EMAGE:19054 same embryo
 EMAGE:19055 same embryo
 EurExpress:euxassay_015911 same experiment
 MGI:4826006 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS