Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19059

Rai14 retinoic acid induced 14 ( MGI:1922896)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19059 EMAGE:19059 EMAGE:19059 EMAGE:19059 EMAGE:19059
"Pseudo-wholemount" of euxassay_015953. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015953_01 euxassay_015953_02 euxassay_015953_03 euxassay_015953_04
EMAGE:19059 EMAGE:19059 EMAGE:19059 EMAGE:19059 EMAGE:19059
euxassay_015953_05 euxassay_015953_06 euxassay_015953_07 euxassay_015953_08 euxassay_015953_09
EMAGE:19059 EMAGE:19059 EMAGE:19059 EMAGE:19059 EMAGE:19059
euxassay_015953_10 euxassay_015953_11 euxassay_015953_12 euxassay_015953_13 euxassay_015953_14
EMAGE:19059 EMAGE:19059 EMAGE:19059 EMAGE:19059 EMAGE:19059
euxassay_015953_15 euxassay_015953_16 euxassay_015953_17 euxassay_015953_18 euxassay_015953_19
EMAGE:19059 EMAGE:19059 EMAGE:19059 EMAGE:19059
euxassay_015953_20 euxassay_015953_21 euxassay_015953_22 euxassay_015953_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19059Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19059_wholemount_strong.wlz
19059_wholemount_moderate.wlz
19059_wholemount_weak.wlz
19059_wholemount_possible.wlz
19059_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19059_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 13 14 17 18 19 21 22 23
axial musculature
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 05 06 22 23
physiological umbilical hernia
weak weak
regionalweak expression: see section 14
diencephalon roof plate
weak weak
regionalweak expression: see section 11 12
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 15 16 17 18 19 20 21 22 23 weak expression: see section 11 14
medulla oblongata floor plate
weak weak
regionalweak expression: see section 12
metencephalon floor plate
weak weak
regionalweak expression: see section 12
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 13 14 15 weak expression: see section 08 09 10
mandible
moderate moderate
regionalmoderate expression: see section 03 04 05 17 18 20 21 22 23 weak expression: see section 06 07 08 09 10 11 13 16 19
lower jaw incisor
weak weak
regionalweak expression: see section 12
maxilla
moderate moderate
regionalmoderate expression: see section 04 05 18 20 21 22 23 weak expression: see section 06 07 08 09 10 11 19
palatal shelf
weak weak
regionalweak expression: see section 12 13 15 16
upper jaw incisor
weak weak
regionalweak expression: see section 12
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18 19
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 15 16 17 weak expression: see section 13 14
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 05 21 22 23 weak expression: see section 02 03 04 06 07
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 10 17 weak expression: see section 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63331
Entity Detected:Rai14, retinoic acid induced 14 ( MGI:1922896)
Sequence:sense strand is shown

>T63331
ATCCATAGTGTGCACTGTGACCCATCGTAGCATCTTTTCCAGAGGTTTCTGAGGGCTAGTCCCAAGAGAA
GATACCCTCTTCAGAACTGCATAGGTACTCCAGACCAGCAGAGGTGAAAGACCCTGCTATCTCTTCAGAA
TCTAGCACTGGGATTGGCACCATCCCGGTGGCTTTATGGAGTGATGTGCTGAAGCCACCATGCAGTGAGT
GGTCCTTGATCCCTGCCTTTGGGATGTGCCATTCAGCACAGGAGAGCATTTTGCCTTCCATTCCCCAAAT
ATGATTTAATTCCTAACCAAACTAAAATGACACTAGAAGTGAATGCTTAAGACCCTTTCTCCTGTGGATT
TAAAAACTCTACTCTGTCCCCCCAGCTGCCTTAAATCTCATCCCCTTGCTTGTGGTCTCATCATTTGATG
AGTATCATTAACTAAAGTACAACGTTTTAAGCCAAGAGTGAAGTCTCCTTAAAAGTTTTCAGTAAGTCAA
CATACTGTAAATTTTCTATGCAAACTTGCCTAGAAAACTTTCCACAATGCTCAGGAAGTCCAGATATTTG
TATTTCAACAAAGGACAGTAAACTATGTGTTTACAGCCAAAAGACATGCCTCATAGTTCTTAACCTCAAT
TTTTTAAAAGTGTTTTTTTTTCCTCTATGATATTTTTATTGGCTTTTAAAGATGTTTTCATAGCTAAAGC
CCTAAGTAAGTGAGATTAGATTATATTAACATTATTTTTAGATAAACATACTTAAGACTTCTCAAAAATG
TAACTTTTTCCTCAAAAGTTTTCAGAGGGTAGTTATATATTCCAAACTCAGTATGAGCTGCCACCAGAAC
CACTAGGAATTTCTGTAGTCTACTTCTGAATGCAGTAAATACTCCTTTTGCCCGTTGAACTTGTAAACAC
CTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 95544. Forward Primer - name:095544_F_cDNA_Rai14, sequence:ATCCATAGTGTGCACTGTGACC; Reverse Primer - name:095544_N_SP6_cDNA_Rai14, sequence:GAGGTGTTTACAAGTTCAACGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19060 same embryo
 EMAGE:19058 same embryo
 EMAGE:19061 same embryo
 EMAGE:19057 same embryo
 EurExpress:euxassay_015953 same experiment
 MGI:4827595 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS