Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19127

Mir200a microRNA 200a ( MGI:2676874)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19127 EMAGE:19127 EMAGE:19127 EMAGE:19127 EMAGE:19127
"Pseudo-wholemount" of euxassay_019401. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019401_01 euxassay_019401_02 euxassay_019401_03 euxassay_019401_04
EMAGE:19127 EMAGE:19127 EMAGE:19127 EMAGE:19127 EMAGE:19127
euxassay_019401_05 euxassay_019401_06 euxassay_019401_07 euxassay_019401_08 euxassay_019401_09
EMAGE:19127 EMAGE:19127 EMAGE:19127 EMAGE:19127 EMAGE:19127
euxassay_019401_10 euxassay_019401_11 euxassay_019401_12 euxassay_019401_13 euxassay_019401_14
EMAGE:19127 EMAGE:19127 EMAGE:19127 EMAGE:19127 EMAGE:19127
euxassay_019401_15 euxassay_019401_16 euxassay_019401_17 euxassay_019401_18 euxassay_019401_19
EMAGE:19127 EMAGE:19127 EMAGE:19127 EMAGE:19127 EMAGE:19127
euxassay_019401_20 euxassay_019401_21 euxassay_019401_22 euxassay_019401_23 euxassay_019401_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19127Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19127_wholemount_strong.wlz
19127_wholemount_moderate.wlz
19127_wholemount_weak.wlz
19127_wholemount_possible.wlz
19127_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19127_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 15 16 17 18 moderate expression: see section 08 09 19
vomeronasal organ
strong strong
regionalstrong expression: see section 12 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70319
Entity Detected:Mir200a, microRNA 200a ( MGI:2676874)
Sequence:sense strand is shown

>T70319
TAACACTGTCTGGTAACGATGT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-200a was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19125 same embryo
 EMAGE:19124 same embryo
 EMAGE:19126 same embryo
 EMAGE:19123 same embryo
 EurExpress:euxassay_019401 same experiment
 MGI:4826240 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS