Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19147

Mir34b microRNA 34b ( MGI:3619364)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19147 EMAGE:19147 EMAGE:19147 EMAGE:19147 EMAGE:19147
"Pseudo-wholemount" of euxassay_019405. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019405_01 euxassay_019405_02 euxassay_019405_03 euxassay_019405_04
EMAGE:19147 EMAGE:19147 EMAGE:19147 EMAGE:19147 EMAGE:19147
euxassay_019405_05 euxassay_019405_06 euxassay_019405_07 euxassay_019405_08 euxassay_019405_09
EMAGE:19147 EMAGE:19147 EMAGE:19147 EMAGE:19147 EMAGE:19147
euxassay_019405_10 euxassay_019405_11 euxassay_019405_12 euxassay_019405_13 euxassay_019405_14
EMAGE:19147 EMAGE:19147 EMAGE:19147 EMAGE:19147 EMAGE:19147
euxassay_019405_15 euxassay_019405_16 euxassay_019405_17 euxassay_019405_18 euxassay_019405_19
EMAGE:19147 EMAGE:19147 EMAGE:19147
euxassay_019405_20 euxassay_019405_21 euxassay_019405_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19147Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19147_wholemount_strong.wlz
19147_wholemount_moderate.wlz
19147_wholemount_weak.wlz
19147_wholemount_possible.wlz
19147_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19147_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 05 06 16 17 weak expression: see section 01 02 03 07 08 09 15 18 19 20 21
humerus
weak weak
regionalweak expression: see section 01 02 03 19 20 21 22
fibula
weak weak
regionalweak expression: see section 02 22
tibia
weak weak
regionalweak expression: see section 02 22
femur
weak weak
regionalweak expression: see section 02 04 05 18 19 20
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 05 06 07 09 10 13 14 15 16
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 17
hyoid
weak weak
regionalweak expression: see section 09 10 11 12 13 14
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 05 16 17 weak expression: see section 02 03 04 06 07 08 12 13 14 15 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 05 06 09 12 13 14 16 weak expression: see section 07 08 10 11 15
basioccipital bone
weak weak
regionalweak expression: see section 05 06 09 10 11 12 13 14 15
basisphenoid bone
weak weak
regionalweak expression: see section 09 10 11 12 13
exoccipital bone
weak weak
regionalweak expression: see section 16 17
temporal bone
weak weak
regionalweak expression: see section 01 16
orbito-sphenoid
weak weak
regionalweak expression: see section 05 06 16 17
viscerocranium
weak weak
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 05 07 16
scapula
weak weak
regionalweak expression: see section 01 02 03 18 19 20
pelvic girdle skeleton
weak weak
regionalweak expression: see section 07 08 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70431
Entity Detected:Mir34b, microRNA 34b ( MGI:3619364)
Sequence:sense strand is shown

>T70431
AGGCAGTGTAATTAGCTGATTGT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-34b-5p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19153 same embryo
 EMAGE:19152 same embryo
 EMAGE:19148 same embryo
 EMAGE:19150 same embryo
 EMAGE:19151 same embryo
 EMAGE:19149 same embryo
 EurExpress:euxassay_019405 same experiment
 MGI:4826274 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS