Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19158

Mir345 microRNA 345 ( MGI:3619361)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19158 EMAGE:19158 EMAGE:19158 EMAGE:19158 EMAGE:19158
"Pseudo-wholemount" of euxassay_019443. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019443_01 euxassay_019443_02 euxassay_019443_03 euxassay_019443_04
EMAGE:19158 EMAGE:19158 EMAGE:19158 EMAGE:19158 EMAGE:19158
euxassay_019443_05 euxassay_019443_06 euxassay_019443_07 euxassay_019443_08 euxassay_019443_09
EMAGE:19158 EMAGE:19158 EMAGE:19158 EMAGE:19158 EMAGE:19158
euxassay_019443_10 euxassay_019443_11 euxassay_019443_12 euxassay_019443_13 euxassay_019443_14
EMAGE:19158 EMAGE:19158 EMAGE:19158 EMAGE:19158 EMAGE:19158
euxassay_019443_15 euxassay_019443_16 euxassay_019443_17 euxassay_019443_18 euxassay_019443_19
EMAGE:19158 EMAGE:19158 EMAGE:19158 EMAGE:19158 EMAGE:19158
euxassay_019443_20 euxassay_019443_21 euxassay_019443_22 euxassay_019443_23 euxassay_019443_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19158Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19158_wholemount_strong.wlz
19158_wholemount_moderate.wlz
19158_wholemount_weak.wlz
19158_wholemount_possible.wlz
19158_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19158_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70426
Entity Detected:Mir345, microRNA 345 ( MGI:3619361)
Sequence:sense strand is shown

>T70426
CCTGAACTAGGGGTCTGGAGAC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-345-3p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19160 same embryo
 EMAGE:19157 same embryo
 EMAGE:19156 same embryo
 EMAGE:19159 same embryo
 EurExpress:euxassay_019443 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS