Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19162

Mir762 microRNA 762 ( MGI:3691607)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19162 EMAGE:19162 EMAGE:19162 EMAGE:19162 EMAGE:19162
"Pseudo-wholemount" of euxassay_019411. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019411_01 euxassay_019411_02 euxassay_019411_03 euxassay_019411_04
EMAGE:19162 EMAGE:19162 EMAGE:19162 EMAGE:19162 EMAGE:19162
euxassay_019411_05 euxassay_019411_06 euxassay_019411_07 euxassay_019411_08 euxassay_019411_09
EMAGE:19162 EMAGE:19162 EMAGE:19162 EMAGE:19162 EMAGE:19162
euxassay_019411_10 euxassay_019411_11 euxassay_019411_12 euxassay_019411_13 euxassay_019411_14
EMAGE:19162 EMAGE:19162 EMAGE:19162 EMAGE:19162 EMAGE:19162
euxassay_019411_15 euxassay_019411_16 euxassay_019411_17 euxassay_019411_18 euxassay_019411_19
EMAGE:19162 EMAGE:19162 EMAGE:19162 EMAGE:19162 EMAGE:19162
euxassay_019411_20 euxassay_019411_21 euxassay_019411_22 euxassay_019411_23 euxassay_019411_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19162Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19162_wholemount_strong.wlz
19162_wholemount_moderate.wlz
19162_wholemount_weak.wlz
19162_wholemount_possible.wlz
19162_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19162_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70181
Entity Detected:Mir762, microRNA 762 ( MGI:3691607)
Sequence:sense strand is shown

>T70181
GGGGCTGGGGCCGGGACAGAGC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-762 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19161 same embryo
 EurExpress:euxassay_019411 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS