Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19165

Cdhr1 cadherin-related family member 1 ( MGI:2157782)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19165 EMAGE:19165 EMAGE:19165 EMAGE:19165 EMAGE:19165
"Pseudo-wholemount" of euxassay_009099. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009099_01 euxassay_009099_02 euxassay_009099_03 euxassay_009099_04
EMAGE:19165 EMAGE:19165 EMAGE:19165 EMAGE:19165 EMAGE:19165
euxassay_009099_05 euxassay_009099_06 euxassay_009099_07 euxassay_009099_08 euxassay_009099_09
EMAGE:19165 EMAGE:19165 EMAGE:19165 EMAGE:19165 EMAGE:19165
euxassay_009099_10 euxassay_009099_11 euxassay_009099_12 euxassay_009099_13 euxassay_009099_14
EMAGE:19165 EMAGE:19165 EMAGE:19165 EMAGE:19165 EMAGE:19165
euxassay_009099_15 euxassay_009099_16 euxassay_009099_17 euxassay_009099_18 euxassay_009099_19
EMAGE:19165
euxassay_009099_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19165Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19165_wholemount_strong.wlz
19165_wholemount_moderate.wlz
19165_wholemount_weak.wlz
19165_wholemount_possible.wlz
19165_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19165_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 08 09 10
sublingual gland primordium
strong strong
regionalstrong expression: see section 07 08 11 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 04 05 06 13 14 15
pancreas
moderate moderate
regionalmoderate expression: see section 07 08 12
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 16 17 18 19
telencephalon mantle layer
strong strong
single cellstrong expression: see section 01 02 03 04 15 16 17 18 19 20
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 11 13
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 12 14
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 05 06 07 09 10 11 12 moderate expression: see section 02 03 04 08 13 14
pons mantle layer
strong strong
single cellstrong expression: see section 04 05 13
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 05 13 14
trigeminal v ganglion
strong strong
regionalstrong expression: see section 17 18 moderate expression: see section 02 03 04 05 13 14 15 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 04 moderate expression: see section 14
ventral grey horn
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10
dorsal root ganglion
strong strong
single cellstrong expression: see section 04 05 06 07 08 09 11 12 13
extrinsic ocular muscle
strong strong
regionalstrong expression: see section 01 02 03 04 17 18 19 20
naris
strong strong
regionalstrong expression: see section 09 12
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 06 07 08 10 11 12 13 14 15
vomeronasal organ
strong strong
regionalstrong expression: see section 08 11
renal cortex
moderate moderate
regionalmoderate expression: see section 05 06 07 12 13 14 15 16
medullary renal tubule
strong strong
regionalstrong expression: see section 06 07 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2402
Entity Detected:Cdhr1, cadherin-related family member 1 ( MGI:2157782)
Sequence:sense strand is shown

>T2402
AAGCAAAAGTTTGAGAAGAAGAGTTTAGACAACAAGGCCTATATCTAGAGTGTGTCCCATGATTTTTCTC
TTCTCTTCCCCCAATTCTGACCCTCAAGGTCACCCCTATTTTGTATAATGTTGTAACACTATATGCAGGA
CTCTACAAAGGGCTTTGGGCAAGAGATGCCTCAGACTGTGAGATGCAGTTGGCAAATACATACCCACTGC
CCAAATCCTTGACACATCTATAATGCTCTCTATTCTTCAGAGAATAGAAGTCCACAAGGAGTCAAGTCTG
TGTATTTCTACCCACCAACTCTAGACCCCACAATCACTGGAGTCCTCCTGGGGCCTTGTCATCTTTAGTT
GAGAAGTAGGGCCCCTGGCCACAAGTAACAAGAGTGGCAAGAATCTGGATCCCCAAGCTTCAGCCAACCA
ACAGGTTAATGGAGGTTTGTTCTCAGCTGAAGTTGAAAGTCAGTGAGCTTTGTAGGATGTAGCGATACAA
ACAGGTAAGAAAAG
Notes:The probe template was PCR amplified from IMAGE:1225022 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1225022 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19166 same embryo
 EurExpress:euxassay_009099 same experiment
 MGI:4823774 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS