Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19188

Ncdn neurochondrin ( MGI:1347351)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19188 EMAGE:19188 EMAGE:19188 EMAGE:19188 EMAGE:19188
"Pseudo-wholemount" of euxassay_001888. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001888_01 euxassay_001888_02 euxassay_001888_03 euxassay_001888_04
EMAGE:19188 EMAGE:19188 EMAGE:19188 EMAGE:19188 EMAGE:19188
euxassay_001888_05 euxassay_001888_06 euxassay_001888_07 euxassay_001888_08 euxassay_001888_09
EMAGE:19188 EMAGE:19188 EMAGE:19188 EMAGE:19188 EMAGE:19188
euxassay_001888_10 euxassay_001888_11 euxassay_001888_12 euxassay_001888_13 euxassay_001888_14
EMAGE:19188 EMAGE:19188 EMAGE:19188 EMAGE:19188 EMAGE:19188
euxassay_001888_15 euxassay_001888_16 euxassay_001888_17 euxassay_001888_18 euxassay_001888_19
EMAGE:19188 EMAGE:19188 EMAGE:19188 EMAGE:19188
euxassay_001888_20 euxassay_001888_21 euxassay_001888_22 euxassay_001888_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19188Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19188_wholemount_strong.wlz
19188_wholemount_moderate.wlz
19188_wholemount_weak.wlz
19188_wholemount_possible.wlz
19188_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19188_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
olfactory cortex marginal layer
strong strong
homogeneousstrong expression: see section 09 10 11 14 15 moderate expression: see section 16
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 16 17 18 19 20 21
ventral grey horn
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 08 09 weak expression: see section 10
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2446
Entity Detected:Ncdn, neurochondrin ( MGI:1347351)
Sequence:sense strand is shown

>T2446
TGGCCTCGAGCCAGATTCGGACGAGGCCCTGTGCCAGGCGTACCTGGGGCATGGCTACGGCTTTGACCAG
GCTCTGGCACTCTTGGTGGGGCTGCTGGCTGCTGCAGAGACACAGTGCTGGAAGGAGGCGGAGCCCGACC
TGCTGGCTGTGTTGCGAGGCCTCAGTGAGGATTTCCAAAGAGCCGAAGATGCCAGCAAGTTTGAGCTCTG
CCAGCTGCTGCCCCTTTTTCTGCCCCCAACAACTGTGCCCCCTGAATGCCACCGAGATCTGCAGGCTGGG
CTGGCACGAATCCTAGGAAGCAAGTTGAGCTCCTGGCAGCGCAACCCTGCACTGAAGCTGGCAGCCCGCC
TGGCTCATGCCTGCGGCTCCGACTGGATCCCAGTGGGCAGCTCTGGGAGCAAGTTTCTGGCCCTGCTCGT
GAATCTGGCGTGCGTGGAGGTACGGCTGGCTCTCGAGGAGACAGGCACAGAGGTGAAAGAAGACGTGGTA
ACAGCCTGCTATGCCCTTATGGAATTGGGGATCCAGGAGTGCACCCGCTGTGAG
Notes:The probe template was PCR amplified from IMAGE:1246945 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1246945 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19189 same embryo
 EMAGE:19190 same embryo
 EMAGE:19187 same embryo
 EurExpress:euxassay_001888 same experiment
 MGI:4826615 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS