Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19198

Fam134a family with sequence similarity 134, member A ( MGI:2388278)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19198 EMAGE:19198 EMAGE:19198 EMAGE:19198 EMAGE:19198
"Pseudo-wholemount" of euxassay_009161. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009161_01 euxassay_009161_02 euxassay_009161_03 euxassay_009161_04
EMAGE:19198 EMAGE:19198 EMAGE:19198 EMAGE:19198 EMAGE:19198
euxassay_009161_05 euxassay_009161_06 euxassay_009161_07 euxassay_009161_08 euxassay_009161_09
EMAGE:19198 EMAGE:19198 EMAGE:19198 EMAGE:19198 EMAGE:19198
euxassay_009161_10 euxassay_009161_11 euxassay_009161_12 euxassay_009161_13 euxassay_009161_14
EMAGE:19198 EMAGE:19198 EMAGE:19198 EMAGE:19198 EMAGE:19198
euxassay_009161_15 euxassay_009161_16 euxassay_009161_17 euxassay_009161_18 euxassay_009161_19
EMAGE:19198 EMAGE:19198 EMAGE:19198 EMAGE:19198
euxassay_009161_20 euxassay_009161_21 euxassay_009161_22 euxassay_009161_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19198Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19198_wholemount_strong.wlz
19198_wholemount_moderate.wlz
19198_wholemount_weak.wlz
19198_wholemount_possible.wlz
19198_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19198_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
spottedstrong expression: see section 10 11 12 13
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 16 17 18
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 16
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 15 16 17 18 19
vagus x ganglion
strong strong
regionalstrong expression: see section 06 07 15 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 15 16 17
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 14
spinal cord
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 09 14
cervical ganglion
strong strong
regionalstrong expression: see section 08 15
thoracic ganglion
strong strong
regionalstrong expression: see section 10 11
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15 16 17
retina
strong strong
regionalstrong expression: see section 01 02 03 19 20 21 22
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 12 13 14 moderate expression: see section 15
tongue
strong strong
spottedstrong expression: see section 12
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3487
Entity Detected:Fam134a, family with sequence similarity 134, member A ( MGI:2388278)
Sequence:sense strand is shown

>T3487
GCTGACAGTGAGGGTGCGGGGTCAGGCGCCCAGCCGCACCTGCTGAGTGTGCCCGAGTTGTGCAGATACC
TGGCTGAGAGCTGGCTCACCTTCCAGATTCACCTGCAAGAGCTGTTGCAGTACAAGAGGCAGAATCCAGC
TCAGTTCTGCGCTCGGGGCTGCGCTGCCTGTGCTGTGCTGGCTGTGTTGGGACACTATGTTCCGGGAGTT
ATGATTTCCTACATTGTCTTGCTGAGTATCCTGCTGTGGCCCCTGGTGGTCTATCACGAGTTGATCCAGA
GGATGTATACTCGCCTGGAGCCCTTGCTCATGCAGCTGGACTACAGCATGAAAGCTGAAGCTGATGCCCT
GCACCACAAACATGACAAGAGAAAGCGCCAAGGGAAGAGTGCACCCCCAGCAGGAGATGAGCCACTGGCG
GAAACAGAGAGTGAAAGCGAGGCAGAGTTGGCTGGCTTCTCTCCAGTGGTGGATGTGAAGAAAACAGCCC
TGGCCTTGGCTATTACAGACTCTGAGCT
Notes:The probe template was PCR amplified from IMAGE:333628 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:333628 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19196 same embryo
 EMAGE:19197 same embryo
 EurExpress:euxassay_009161 same experiment
 MGI:4824704 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS