Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19227

Cplx1 complexin 1 ( MGI:104727)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19227 EMAGE:19227 EMAGE:19227 EMAGE:19227 EMAGE:19227
"Pseudo-wholemount" of euxassay_009164. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009164_01 euxassay_009164_02 euxassay_009164_03 euxassay_009164_04
EMAGE:19227 EMAGE:19227 EMAGE:19227 EMAGE:19227 EMAGE:19227
euxassay_009164_05 euxassay_009164_06 euxassay_009164_07 euxassay_009164_08 euxassay_009164_09
EMAGE:19227 EMAGE:19227 EMAGE:19227 EMAGE:19227 EMAGE:19227
euxassay_009164_10 euxassay_009164_11 euxassay_009164_12 euxassay_009164_13 euxassay_009164_14
EMAGE:19227 EMAGE:19227 EMAGE:19227 EMAGE:19227 EMAGE:19227
euxassay_009164_15 euxassay_009164_16 euxassay_009164_17 euxassay_009164_18 euxassay_009164_19
EMAGE:19227
euxassay_009164_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19227Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19227_wholemount_strong.wlz
19227_wholemount_moderate.wlz
19227_wholemount_weak.wlz
19227_wholemount_possible.wlz
19227_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19227_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 04 05 09 10 11 12 13 14 moderate expression: see section 06
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13
medulla oblongata basal plate marginal layer
strong strong
regionalstrong expression: see section 14
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 10 11 12 13 14 15 moderate expression: see section 06 07 08 16
pons mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 07 08 09 10 11 12 13 14 15 moderate expression: see section 06 16
midbrain mantle layer
strong strong
regionalstrong expression: see section 02 03 04 10 11 12 moderate expression: see section 05 06 07 08 09 13
tegmentum
strong strong
regionalstrong expression: see section 06 07 08 09
facial vii ganglion
strong strong
regionalstrong expression: see section 02 03 04 15 16 17
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 03 04 14
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 14 15 16 17 18
vagus x ganglion
strong strong
regionalstrong expression: see section 04 13
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 03 04 05 13 14
trigeminal v nerve
strong strong
regionalstrong expression: see section 07 08 14
spinal cord
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10
basal columns
strong strong
regionalstrong expression: see section 05 06 07 08 09 10
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 06 09 10 11
cervical ganglion
strong strong
regionalstrong expression: see section 05 12 13
thoracic ganglion
strong strong
regionalstrong expression: see section 07 08 09 10
dorsal root ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 10 11 12
neural retina
strong strong
regionalstrong expression: see section 20 moderate expression: see section 02 03
tongue
strong strong
spottedstrong expression: see section 10 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3503
Entity Detected:Cplx1, complexin 1 ( MGI:104727)
Sequence:sense strand is shown

>T3503
TGGCCTCGAGCCAGATTCGGACGAGGCACTTTCAGAGTCCCATCTTTCCCTGATCCCACCTCTCCCTGGT
GGCCTCCTGTCCTCTTCATGTGGGCAGGCAGTCTCCTAGGATCTTCCTGGCTTTACCCCTGGACACCTAC
CCTCCAAATGCCCGTCTTCCTAAAAGCCCTGGGTTCTGGTGATTCCCGCCCGTGCAGAGCAGACAGAGGG
CCGCATAATCAAGTGTCCCACCCTCTCCACTATTCCTCCTCTGAAGGGCTGACAGTGGCCGGTAAATGCA
AGCTCCTGGGCTTGGGCTGTGGTGTTTTGTTCTGTGTGTGGCCCAGGGGCAGTATGACCCAACTACTCCC
CCTTTGCCCAGCCAGCAGCCATTGTTCTTCATATTTGTTTAATTTACATCATAATATGTTGAATCTCAGG
TAAATGAGGTCTGTATTTGGTAAGTTTTATCTTGACAGAAAGGCCAGCCTGGTCTTCCCATAACCCTTCC
TGTCCACAGTAAAACTGAATTAAGTGTCCATGAGTTTTGGGCCAGGTGTGTGGCTTAGCATTGACCTTC
Notes:The probe template was PCR amplified from IMAGE:335763 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:335763 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19226 same embryo
 EMAGE:19229 same embryo
 EMAGE:19228 same embryo
 EurExpress:euxassay_009164 same experiment
 MGI:4824026 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS