EMAGE mouse gene expression spatial database

EMAGE:19228

Cd52 CD52 antigen ( MGI:1346088)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_009244. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_009244_01	euxassay_009244_02	euxassay_009244_03	euxassay_009244_04

euxassay_009244_05	euxassay_009244_06	euxassay_009244_07	euxassay_009244_08	euxassay_009244_09

euxassay_009244_10	euxassay_009244_11	euxassay_009244_12	euxassay_009244_13	euxassay_009244_14

euxassay_009244_15	euxassay_009244_16	euxassay_009244_17	euxassay_009244_18	euxassay_009244_19

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

mesenchyme

strong

single cell

strong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19

thymus primordium

strong

single cell

strong expression: see section 07 08 09 10

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T2468
Entity Detected:	Cd52, CD52 antigen ( MGI:1346088)
Sequence:	sense strand is shown >T2468 TCGGACGAGGATCTCTCAAGCTGCTACAGAGCCCAGGAAGATTTCAGGATGAAGAGCTTCCTCCTCTTCC TCACTATCATTCTTCTGGTTGTGATTCAGATACAAACAGGATCCTTGGGACAAGCCACTACGGCCGCTTC TGGTACTAACAAAAACAGCACCTCCACCAAAAAAACCCCCTTAAAGAGTGGGGCCTCATCCATCATCGAT GCGGGTGCCTGCAGTTTCCTCTTCTTTGCCAATACCTTAATGTGCCTCTTCTACCTCAGCTGAGGTGAAG GCGCAGCTTCTGAAGCCCCGTGCTCCACCCACTGCTGCCACCATCAGTAGCGAGAGACATCCCAACCCAC GGGAAGGGTTGATAGCAGATATCCAAGGAGGCTAAAGTTGACAGCCAATGGCCGGAATGGGAGCGGGGCC GTGACACCCAGCTAGGGCACAATAAAGTTATACTTATGCTTAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:1248244 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1248244 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:19227 same embryo
	EMAGE:19226 same embryo
	EMAGE:19229 same embryo
	EurExpress:euxassay_009244 same experiment
	MGI:4823736 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source