Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19254

Tbpl1 TATA box binding protein-like 1 ( MGI:1339946)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19254 EMAGE:19254 EMAGE:19254 EMAGE:19254 EMAGE:19254
"Pseudo-wholemount" of euxassay_019419. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019419_01 euxassay_019419_02 euxassay_019419_03 euxassay_019419_04
EMAGE:19254 EMAGE:19254 EMAGE:19254 EMAGE:19254 EMAGE:19254
euxassay_019419_05 euxassay_019419_06 euxassay_019419_07 euxassay_019419_08 euxassay_019419_09
EMAGE:19254 EMAGE:19254 EMAGE:19254 EMAGE:19254 EMAGE:19254
euxassay_019419_10 euxassay_019419_11 euxassay_019419_12 euxassay_019419_13 euxassay_019419_14
EMAGE:19254 EMAGE:19254 EMAGE:19254 EMAGE:19254 EMAGE:19254
euxassay_019419_15 euxassay_019419_16 euxassay_019419_17 euxassay_019419_18 euxassay_019419_19
EMAGE:19254 EMAGE:19254 EMAGE:19254 EMAGE:19254 EMAGE:19254
euxassay_019419_20 euxassay_019419_21 euxassay_019419_22 euxassay_019419_23 euxassay_019419_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19254Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19254_wholemount_strong.wlz
19254_wholemount_moderate.wlz
19254_wholemount_weak.wlz
19254_wholemount_possible.wlz
19254_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19254_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 09 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 19 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 17 18
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 14
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 15
thoracic ganglion
weak weak
regionalweak expression: see section 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 14 15 weak expression: see section 16
neural retina
weak weak
regionalweak expression: see section 02 03 04 23 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2546
Entity Detected:Tbpl1, TATA box binding protein-like 1 ( MGI:1339946)
Sequence:sense strand is shown

>T2546
TGGCCTCGAGCCAGATTCGGCACGAGGCCGAGCTCGAGCCTTGGGGGGCTCCTAGCAACGGGCCTGGGCG
GGAGTTCCATGGAGACTGGGGAGCGGACCCGTTTTATCTTCATCCTTGTCCTCCAGCTTCTTCTCCGCGT
CCGACGCAACCAGCAGCAGCGCTGCCGCCGTGTCCTTTACGACCGCCCCGTCTTCCCACGGATGTGATCT
TCGTGGTGGGAACCAAGTTTCTAAACTACCCCAATGGATGCAGACAGTGATGTTGCATTGGACATTTTAA
TTACAAATGTAGTCTGTGTTTTTAGAACAAGATGCCATTTGAACTTAAGGAAGATTGCTTTGGAGGGAGC
AAATGTAATTTATAAGCGTGATGTTGGGAAAGTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACA
ATTTGGTCCTCAGGAAAAATTATTTGCACTGGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGAC
GTTTAGCCCGTAGTCTGCAGAAACTAGGTTTTCAGGTCATCTTCACAGATTTTA
Notes:The probe template was PCR amplified from IMAGE:1382180 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1382180 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19258 same embryo
 EMAGE:19256 same embryo
 EMAGE:19253 same embryo
 EMAGE:19257 same embryo
 EMAGE:19255 same embryo
 EurExpress:euxassay_019419 same experiment
 MGI:4828616 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS