Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19258

Mical3 microtubule associated monoxygenase, calponin and LIM domain containing 3 ( MGI:2442733)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19258 EMAGE:19258 EMAGE:19258 EMAGE:19258 EMAGE:19258
"Pseudo-wholemount" of euxassay_001874. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001874_01 euxassay_001874_02 euxassay_001874_03 euxassay_001874_04
EMAGE:19258 EMAGE:19258 EMAGE:19258 EMAGE:19258 EMAGE:19258
euxassay_001874_05 euxassay_001874_06 euxassay_001874_07 euxassay_001874_08 euxassay_001874_09
EMAGE:19258 EMAGE:19258 EMAGE:19258 EMAGE:19258 EMAGE:19258
euxassay_001874_10 euxassay_001874_11 euxassay_001874_12 euxassay_001874_13 euxassay_001874_14
EMAGE:19258 EMAGE:19258 EMAGE:19258 EMAGE:19258 EMAGE:19258
euxassay_001874_15 euxassay_001874_16 euxassay_001874_17 euxassay_001874_18 euxassay_001874_19
EMAGE:19258 EMAGE:19258 EMAGE:19258 EMAGE:19258
euxassay_001874_20 euxassay_001874_21 euxassay_001874_22 euxassay_001874_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19258Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19258_wholemount_strong.wlz
19258_wholemount_moderate.wlz
19258_wholemount_weak.wlz
19258_wholemount_possible.wlz
19258_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19258_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 16 17 18 19 20
interdigital region between hindlimb digits 1 and 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 20 21
interdigital region between hindlimb digits 2 and 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 09 20 21
interdigital region between hindlimb digits 3 and 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 09 20 21
interdigital region between hindlimb digits 4 and 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 09 20 21
vibrissa
strong strong
regionalstrong expression: see section 05 moderate expression: see section 07 08 20 21 22 weak expression: see section 06
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 11 12 13 15 16 17
hindbrain
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain
moderate moderate
homogeneousmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 16 17
spinal cord
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 14 15
not examined not examined
regionalnot examined expression: see section 02 03 04 22 23
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 22 23
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 16 17 18 19 20
bladder
moderate moderate
regionalmoderate expression: see section 11 12 13
nucleus pulposus
moderate moderate
regionalmoderate expression: see section 07
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2548
Entity Detected:Mical3, microtubule associated monoxygenase, calponin and LIM domain containing 3 ( MGI:2442733)
Sequence:sense strand is shown

>T2548
TGGCCTCGAGNCAGATTCGGACGAGGCGCAACGAGTCTGTAGCTCGTTCAAGCAAACTGCTGGGGTGGTG
CCAAAGGCAGACAGAAGGCTATTCAGGAGTCAATGTGACAGATCTCACTATGTCTTGGAAAAGTGGCCTG
GCCCTGTGTGCGATCATCCACAGATACCGCCCCGATCTAATAGACTTTGATTCTTTGGATGAGCAAAACG
TGGAGAAGAATAATCAGCTGGCCTTTGACATCGCTGAGAAGGAACTGGGTATCTCTCCCATCATGACGGG
CAAGGAGATGGCTTCGGTCGGGGAGCCAGACAAGCTGTCCATGGTGATGTACCTCACGCAGTTCTACGAG
ATGTTCAAGGACTCGCTCTCCTCCAGCGACACCCTCGACCTGAATGCAGAGGAGAAAGCCGTCCTGATAG
CCAGCACCAAATCCCCCATCTCCTTCCTGAGCAAACTCGGACAGACCATCTCTCGGAAGCGTTCGCCCAA
GGATAAAAAAGAAAAGGACTCAGATGGGGCTGGAAAGAGGAGAAAAACCAGTCAGTCAGAGGA
Notes:The probe template was PCR amplified from IMAGE:1382292 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1382292 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19256 same embryo
 EMAGE:19253 same embryo
 EMAGE:19257 same embryo
 EMAGE:19255 same embryo
 EMAGE:19254 same embryo
 EurExpress:euxassay_001874 same experiment
 MGI:4826197 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS