Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19299

Stmn2 stathmin-like 2 ( MGI:98241)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19299 EMAGE:19299 EMAGE:19299 EMAGE:19299 EMAGE:19299
"Pseudo-wholemount" of euxassay_009268. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009268_01 euxassay_009268_02 euxassay_009268_03 euxassay_009268_04
EMAGE:19299 EMAGE:19299 EMAGE:19299 EMAGE:19299 EMAGE:19299
euxassay_009268_05 euxassay_009268_06 euxassay_009268_07 euxassay_009268_08 euxassay_009268_09
EMAGE:19299 EMAGE:19299 EMAGE:19299 EMAGE:19299 EMAGE:19299
euxassay_009268_10 euxassay_009268_11 euxassay_009268_12 euxassay_009268_13 euxassay_009268_14
EMAGE:19299 EMAGE:19299 EMAGE:19299 EMAGE:19299 EMAGE:19299
euxassay_009268_15 euxassay_009268_16 euxassay_009268_17 euxassay_009268_18 euxassay_009268_19
EMAGE:19299 EMAGE:19299 EMAGE:19299 EMAGE:19299 EMAGE:19299
euxassay_009268_20 euxassay_009268_21 euxassay_009268_22 euxassay_009268_23 euxassay_009268_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19299Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19299_wholemount_strong.wlz
19299_wholemount_moderate.wlz
19299_wholemount_weak.wlz
19299_wholemount_possible.wlz
19299_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19299_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
greater sac visceral mesothelium
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 15 16 17 18 19
hand
moderate moderate
regionalmoderate expression: see section 23 24 weak expression: see section 01 not examined expression: see section 04 05 06 17 18 19
foot
weak weak
regionalweak expression: see section 04 05 17 18 19
thymus primordium
weak weak
regionalweak expression: see section 09 10 11 12 13
forebrain
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 05 06 18 19 20 21 22 moderate expression: see section 04 07
hindbrain
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain
strong strong
homogeneousstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 15 16 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 15 16 17
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 16 17
spinal cord
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 07 08 13
cervical ganglion
strong strong
regionalstrong expression: see section 07 14
thoracic ganglion
strong strong
regionalstrong expression: see section 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 13 14 15
neural retina
strong strong
regionalstrong expression: see section 01 02 03 22 23 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 14 15 16 17 18
vomeronasal organ
strong strong
regionalstrong expression: see section 11 14
esophagus
strong strong
regionalstrong expression: see section 10 11
tongue
strong strong
regionalstrong expression: see section 11 13 moderate expression: see section 14
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12
hindgut
strong strong
regionalstrong expression: see section 11 12 13 14
midgut
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
lower lip
strong strong
regionalstrong expression: see section 14 15 16 17 moderate expression: see section 06 07 08 18
lower jaw incisor
strong strong
regionalstrong expression: see section 13 16 moderate expression: see section 11 14 15
upper lip
strong strong
regionalstrong expression: see section 20 moderate expression: see section 06 19
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 11 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T573
Entity Detected:Stmn2, stathmin-like 2 ( MGI:98241)
Sequence:sense strand is shown

>T573
TCCTCGAGCCTGTTGGCCTACTGGAGACTCCTCTCTCGCTCTCTCCGCGGCTACAGCTGGACCCTTCTCC
TTTGCCTTCGCCACCACTCCGTGCGTGCACATCCCTACAATGGCTAAAACAGCAATGGCCTACAAGGAAA
AAATGAAGGAGCTGTCTATGCTGTCACTGATCTGCTCCTGCTTCTACCCGGAGCCGCGCAACATCAACAT
CTACACCTACGACGACATGGAGGTGAAGCAGATCAACAAGCGGGCCTCTGGCCAGGCTTTTGAGCTGATC
TTGAAGCCACCATCTCCCATCTCAGAAGCTCCACGAACTCTAGCTTCTCCAAAGAAGAAAGACCTGTCTC
TGGAGGAGATTCAGAAAAAGCTGGAGGCTGCAGAGGAGCGAAGAAAGTCTCAAGAGGCTCAGGTGCTGAA
GCAGTTGGCAGAGAAGAGGGAGCACGAGCGAGAGGTGCTCCAGAAGGCGCTGGAGGAGAACAACAACTTC
AGCAAGATGGCGGAGGAGAAGCTGATCCTGAAGATGGAACAGATTAAGGAAAACCGTGAGGCTAATCTAG
CTGC
Notes:The probe template was PCR amplified from IMAGE:1885016 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1885016 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19302 same embryo
 EMAGE:19300 same embryo
 EMAGE:19301 same embryo
 EurExpress:euxassay_009268 same experiment
 MGI:4828508 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS