Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19320

Iars isoleucine-tRNA synthetase ( MGI:2145219)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19320 EMAGE:19320 EMAGE:19320 EMAGE:19320 EMAGE:19320
"Pseudo-wholemount" of euxassay_001939. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001939_01 euxassay_001939_02 euxassay_001939_03 euxassay_001939_04
EMAGE:19320 EMAGE:19320 EMAGE:19320 EMAGE:19320 EMAGE:19320
euxassay_001939_05 euxassay_001939_06 euxassay_001939_07 euxassay_001939_08 euxassay_001939_09
EMAGE:19320 EMAGE:19320 EMAGE:19320 EMAGE:19320 EMAGE:19320
euxassay_001939_10 euxassay_001939_11 euxassay_001939_12 euxassay_001939_13 euxassay_001939_14
EMAGE:19320 EMAGE:19320 EMAGE:19320 EMAGE:19320 EMAGE:19320
euxassay_001939_15 euxassay_001939_16 euxassay_001939_17 euxassay_001939_18 euxassay_001939_19
EMAGE:19320
euxassay_001939_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19320Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19320_wholemount_strong.wlz
19320_wholemount_moderate.wlz
19320_wholemount_weak.wlz
19320_wholemount_possible.wlz
19320_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19320_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
thymus primordium
strong strong
homogeneousstrong expression: see section 08 09 10 11 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 14 15 16
foregut-midgut junction
moderate moderate
regionalmoderate expression: see section 11 12
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 10 11 15 16 17
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
rest of cerebellum ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 14 15 16 17 18
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 04 05 06 07 08 09 10 11 12 13
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 06 12
cervical ganglion
moderate moderate
regionalmoderate expression: see section 06 14
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 09 10 11 12
hindgut
weak weak
regionalweak expression: see section 08
midgut
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 05 06 07 08 09 10
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 02 03 04 05 07 16 17 19 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 08 09 17 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 08 09 17 18 19
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 weak expression: see section 16 17 18 19 20
renal cortex
moderate moderate
homogeneousmoderate expression: see section 02 03 04 11 12 13
orbito-sphenoid
strong strong
regionalstrong expression: see section 03 04 05 20 moderate expression: see section 01 02
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T688
Entity Detected:Iars, isoleucine-tRNA synthetase ( MGI:2145219)
Sequence:sense strand is shown

>T688
TCTCGAGNCTGTTGGCCTACTGGCTGAAGACTGTTGTTACCAGCGTATTTGGTGTTAAAAATGCAAAGCT
GTCAGTCTTCCACGGTGAAACAGAAATACAGAACCAAACTGACTTGCTGAGCCTCAGTGGGAGGACGCTG
TGTGTGACTGCAGGGGCATCCCCGTCTCCCATCAGCAGCCCCAGCACCCTGCTGTGTCAGTACCTCAACC
TGCAGCTCCTGAACGCAGAGCCACAAGAGTGTTTAACAGGAACTGTGGGCACCCTCCTGCTTGAAAACCC
ACTCGGACAGAACGGCCTCACCCACCAAGGGCTTGTGCATGAAGCAGCCAAGGTGTTCGGACTGAGGAGC
AGGAGGCTAAGGCTGTTCCTGAATGAGACTCAAACACAAGAAATTACAGAAGATATCCCAGTGAAGACTT
TGAATATGAAGACTGTATATGTTTCTGTCTTGCCAACAACTGCAGATGGCTAACAGCTATCAGTATGCCT
TCAGTCAGTCTTCCTTGAATCTACCCATCTCCTTATACACACACTCACACACTCACACTC
Notes:The probe template was PCR amplified from IMAGE:1888916 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1888916 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4825494 same experiment
 EurExpress:euxassay_001939 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS